FvH4_4g00821

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0001042
Physical Location & Seq
Reverse (-)
719125 .. 719692
568 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g00821.t1

Sequence Viewer

Length: 291 bp
ATGGACCAAGTTGGACTCTTGTTTGGGAAGCTGCATTCCTTTGTTAATGGCTACGATCAACTATTTGTCAAGTTGATCAAGTCCAATCGTGGTGGTGATGATCATGAGGAGGAGGATGTTAGTGGGGAGAGAATTATTGTCATGATATTTGAATACAAAATTGCAGAGAAATCCATGGACATCAAGTACAACTTGCTCACCACTCGCTGCCTGGAATACTCTCACCGCAATCCTCCTGAAGAAGAATGTAGGAGATACTTTTCAACTCTTACTAGCACCTATGTGATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.27

Weight (kDa)

5.31

Isoelectric Point (pI)

33.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 226
AcuI CTGAAG 1 cut(s) 258
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 2 cut(s) 152, 264
AjnI CCWGG 1 cut(s) 210
AleI CACNNNNGTG 1 cut(s) 281
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
ApeKI GCWGC 2 cut(s) 31, 207
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 3 cut(s) 107, 190, 215
AvaII GGWCC 1 cut(s) 4
BbvI GCAGC 2 cut(s) 18, 194
BciT130I CCWGG 1 cut(s) 212
BclI TGATCA 2 cut(s) 75, 100
BfaI CTAG 1 cut(s) 273
BisI GCNGC 2 cut(s) 32, 208
BlsI GCNGC 2 cut(s) 33, 209
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 121
BseRI GAGGAG 2 cut(s) 122, 125
BseXI GCAGC 2 cut(s) 18, 194
BsmI GAATGC 1 cut(s) 34
Bsp143I GATC 4 cut(s) 55, 75, 100, 285
Bsp19I CCATGG 1 cut(s) 174
BspACI CCGC 1 cut(s) 226
BspHI TCATGA 2 cut(s) 103, 141
BssECI CCNNGG 1 cut(s) 174
BssMI GATC 4 cut(s) 55, 75, 100, 285
BssT1I CCWWGG 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 212
BstDSI CCRYGG 1 cut(s) 174
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 4 cut(s) 58, 78, 103, 288
BstMBI GATC 4 cut(s) 55, 75, 100, 285
BstNI CCWGG 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 210
BstV1I GCAGC 2 cut(s) 18, 194
BtgI CCRYGG 1 cut(s) 174
BtsCI GGATG 1 cut(s) 121
CciI TCATGA 2 cut(s) 103, 141
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 187
CspCI CAANNNNNGTGG 2 cut(s) 73, 108
CviAII CATG 3 cut(s) 104, 142, 175
CviJI RGCY 2 cut(s) 31, 51
CviKI_1 RGCY 2 cut(s) 31, 51
CviQI GTAC 1 cut(s) 187
DpnI GATC 4 cut(s) 57, 77, 102, 287
DpnII GATC 4 cut(s) 55, 75, 100, 285
Eco130I CCWWGG 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 1 cut(s) 258
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 3 cut(s) 107, 145, 178
FaiI YATR 4 cut(s) 105, 143, 176, 282
FalI AAGNNNNNCTT 2 cut(s) 176, 208
FatI CATG 3 cut(s) 103, 141, 174
FbaI TGATCA 2 cut(s) 75, 100
Fnu4HI GCNGC 2 cut(s) 32, 208
FokI GGATG 1 cut(s) 128
Fsp4HI GCNGC 2 cut(s) 32, 208
FspBI CTAG 1 cut(s) 273
GluI GCNGC 2 cut(s) 32, 208
Hin1II CATG 3 cut(s) 107, 145, 178
HinfI GANTC 1 cut(s) 15
HphI GGTGA 3 cut(s) 107, 190, 215
Hpy188III TCNNGA 3 cut(s) 104, 142, 236
HpyCH4V TGCA 2 cut(s) 34, 164
Hsp92II CATG 3 cut(s) 107, 145, 178
Ksp22I TGATCA 2 cut(s) 75, 100
Kzo9I GATC 4 cut(s) 55, 75, 100, 285
LpnPI CCDG 3 cut(s) 197, 224, 249
Lsp1109I GCAGC 2 cut(s) 18, 194
MaeI CTAG 1 cut(s) 273
MalI GATC 4 cut(s) 57, 77, 102, 287
MboI GATC 4 cut(s) 55, 75, 100, 285
MboII GAAGA 2 cut(s) 251, 254
MluCI AATT 2 cut(s) 132, 159
MlyI GAGTC 1 cut(s) 9
MnlI CCTC 4 cut(s) 100, 103, 106, 243
MseI TTAA 1 cut(s) 45
MslI CAYNNNNRTG 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 212
Mva1269I GAATGC 1 cut(s) 34
MvaI CCWGG 1 cut(s) 212
NcoI CCATGG 1 cut(s) 174
NdeII GATC 4 cut(s) 55, 75, 100, 285
NlaIII CATG 3 cut(s) 107, 145, 178
OliI CACNNNNGTG 1 cut(s) 281
PagI TCATGA 2 cut(s) 103, 141
PctI GAATGC 1 cut(s) 34
PkrI GCNGC 2 cut(s) 33, 209
PleI GAGTC 1 cut(s) 9
PpsI GAGTC 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
RseI CAYNNNNRTG 1 cut(s) 281
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 2 cut(s) 32, 208
Sau3AI GATC 4 cut(s) 55, 75, 100, 285
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 212
SetI ASST 2 cut(s) 33, 281
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 281
Sse9I AATT 2 cut(s) 132, 159
SsiI CCGC 1 cut(s) 226
SspMI CTAG 1 cut(s) 273
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 174
TasI AATT 2 cut(s) 132, 159
TatI WGTACW 1 cut(s) 186
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseI GCWGC 2 cut(s) 31, 207
VpaK11BI GGWCC 1 cut(s) 4
XcmI CCANNNNNNNNNTGG 1 cut(s) 208
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.