Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008262.1

Orthogroup ID

OG0001042

Physical Location & Seq

Genomic Coordinates Forward (+)

2136 .. 2348

Gene Structure 213 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008262.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

atgaggataataaagtcggccttgtctgatgatgattatgatgatgatgatgatgaggaggaggaggatgaggaggaggaggaggaggagggggatgatgtgaacgaggaggaggagggggatgatgtgaacgaggaggaggatgttagcagggtgagaactcttgtcataatatttgaatacgaaattgaggagaaatccatggacatcaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

71

Amino Acids

8.44

Weight (kDa)

4.05

Isoelectric Point (pI)

94.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001042)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g43023 FvH4_4g00821 FvH4_6g46861 FvH4_6g50642 FvH4_6g50762 FvH4_6g50763
rosa_chinensis	RchiOBHm_Chr2g0172011
rosa_laevigata	RLG00000019866 RLG00000021935 RLG00000021943 RLG00000022032 RLG00000022034 RLG00000022036 RLG00000022038 RLG00000022040 RLG00000022042 RLG00000022044 RLG00000022046 RLG00000022049 RLG00000022051 RLG00000022068 RLG00000022070 RLG00000022080 RLG00000022083 RLG00000022086 RLG00000034562
rosa_multiflora	Rmu_sc0008262.1_g000002 Rmu_sc0012445.1_g000001 Rmu_sc0012468.1_g000010 Rmu_sc0036915.1_g000001 Rmu_ssc0000252.1_g000031 Rmu_ssc0000252.1_g000036 Rmu_ssc0000252.1_g000040
rosa_roxburghii	Rroxscaffold_2G00080270 Rroxscaffold_2G00080490
rosa_rugosa	Rorug02G0547700 Rorug02G0555600 Rorug02G0555600 Rorug02G0555700 Rorug02G0556100
rosa_samantha	Rh2BG643700 Rh2BG644000 Rh2BG644100 Rh2BG644500 Rh2BG644600 Rh2BG645800 Rh2CG610600 Rh2CG610800 Rh2CG611200 Rh2CG611500 Rh2CG611700 Rh2CG612000 Rh2DG658500 Rh2DG658800 Rh2DG658900 Rh2DG659100 Rh2DG659400 Rh2DG659700 Rh2DG660000 Rh4BG019700 Rh5BG331700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	179
AoxI	GGCC	1 cut(s)	18
AsuHPI	GGTGA	1 cut(s)	166
BsaJI	CCNNGG	1 cut(s)	201
BseDI	CCNNGG	1 cut(s)	201
BseGI	GGATG	4 cut(s)	73, 100, 127, 148
BshFI	GGCC	1 cut(s)	20
BsnI	GGCC	1 cut(s)	20
Bsp19I	CCATGG	1 cut(s)	201
BspANI	GGCC	1 cut(s)	20
BssECI	CCNNGG	1 cut(s)	201
BssT1I	CCWWGG	1 cut(s)	201
BstDSI	CCRYGG	1 cut(s)	201
BstF5I	GGATG	4 cut(s)	73, 100, 127, 148
BsuRI	GGCC	1 cut(s)	20
BtgI	CCRYGG	1 cut(s)	201
BtsCI	GGATG	4 cut(s)	73, 100, 127, 148
CviAII	CATG	1 cut(s)	202
CviJI	RGCY	1 cut(s)	20
CviKI_1	RGCY	1 cut(s)	20
Eco130I	CCWWGG	1 cut(s)	201
EcoT14I	CCWWGG	1 cut(s)	201
ErhI	CCWWGG	1 cut(s)	201
FaeI	CATG	1 cut(s)	205
FaiI	YATR	3 cut(s)	39, 170, 203
FalI	AAGNNNNNCTT	1 cut(s)	37
FatI	CATG	1 cut(s)	201
FokI	GGATG	4 cut(s)	80, 107, 134, 155
HaeIII	GGCC	1 cut(s)	20
Hin1II	CATG	1 cut(s)	205
HphI	GGTGA	1 cut(s)	166
Hpy166II	GTNNAC	2 cut(s)	103, 130
Hpy188I	TCNGA	1 cut(s)	28
Hpy8I	GTNNAC	2 cut(s)	103, 130
Hsp92II	CATG	1 cut(s)	205
LpnPI	CCDG	1 cut(s)	136
MluCI	AATT	1 cut(s)	186
NcoI	CCATGG	1 cut(s)	201
NlaIII	CATG	1 cut(s)	205
SgeI	CNNG	5 cut(s)	34, 118, 145, 163, 176
Sse9I	AATT	1 cut(s)	186
SspI	AATATT	1 cut(s)	174
StyI	CCWWGG	1 cut(s)	201
TasI	AATT	1 cut(s)	186

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.