RchiOBHm_Chr2g0172011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001042
Physical Location & Seq
Forward (+)
85565592 .. 85565885
294 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53932

Sequence Viewer

Length: 294 bp
ATGGCATTGTACGTTTTCTTCCATGACCGTTGTGAGTATTTTTATGAGGATTATGATTATTTTTCTCCTGGTGATGAGGATGATGTGGACGAGGAAGAGCAGAAGCAGGGGGTGGAAGAGGTGGATGATAGCAGGGTGAGAACTCTTGTCATAATATTTGAATACGAAATTGTGGAGCAAACAACGGACATCAAGCACAAATTGTTGACTAGTCAATGCCTGGAGTACTCTACTCACAACCCTGAAGAAGCTAGAAGGACCAGTTCAACTCTTATTGGCGCCTATGTGATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.52

Weight (kDa)

4.22

Isoelectric Point (pI)

59.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 278
AcuI CTGAAG 1 cut(s) 264
AcyI GRCGYC 1 cut(s) 279
AfaI GTAC 2 cut(s) 11, 227
AgsI TTSAA 2 cut(s) 161, 267
AhlI ACTAGT 1 cut(s) 209
AjnI CCWGG 2 cut(s) 67, 219
AluBI AGCT 1 cut(s) 251
AluI AGCT 1 cut(s) 251
AspLEI GCGC 1 cut(s) 281
AspS9I GGNCC 1 cut(s) 258
AsuHPI GGTGA 2 cut(s) 83, 148
AvaII GGWCC 1 cut(s) 258
BanI GGYRCC 1 cut(s) 278
BarI GAAGNNNNNNTAC 1 cut(s) 34
BciT130I CCWGG 2 cut(s) 69, 221
BcuI ACTAGT 1 cut(s) 209
BfaI CTAG 2 cut(s) 210, 252
BfoI RGCGCY 1 cut(s) 282
BmcAI AGTACT 1 cut(s) 227
Bme1390I CCNGG 2 cut(s) 69, 221
Bme18I GGWCC 1 cut(s) 258
BmgT120I GGNCC 1 cut(s) 258
BmiI GGNNCC 1 cut(s) 280
BmrFI CCNGG 2 cut(s) 69, 221
BpmI CTGGAG 1 cut(s) 242
BsaHI GRCGYC 1 cut(s) 279
Bse1I ACTGG 1 cut(s) 261
BseBI CCWGG 2 cut(s) 69, 221
BseGI GGATG 2 cut(s) 85, 130
BseNI ACTGG 1 cut(s) 261
BshNI GGYRCC 1 cut(s) 278
Bsp143I GATC 1 cut(s) 288
BspLI GGNNCC 1 cut(s) 280
BspQI GCTCTTC 1 cut(s) 90
BspT107I GGYRCC 1 cut(s) 278
BsrI ACTGG 1 cut(s) 261
BssMI GATC 1 cut(s) 288
BssNI GRCGYC 1 cut(s) 279
Bst2UI CCWGG 2 cut(s) 69, 221
Bst4CI ACNGT 1 cut(s) 29
Bst6I CTCTTC 2 cut(s) 90, 111
BstACI GRCGYC 1 cut(s) 279
BstF5I GGATG 2 cut(s) 85, 130
BstH2I RGCGCY 1 cut(s) 282
BstHHI GCGC 1 cut(s) 281
BstKTI GATC 1 cut(s) 291
BstMBI GATC 1 cut(s) 288
BstNI CCWGG 2 cut(s) 69, 221
BstSCI CCNGG 2 cut(s) 67, 219
BtsCI GGATG 2 cut(s) 85, 130
CfoI GCGC 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 258
Csp6I GTAC 2 cut(s) 10, 226
CviAII CATG 1 cut(s) 23
CviJI RGCY 1 cut(s) 251
CviKI_1 RGCY 1 cut(s) 251
CviQI GTAC 2 cut(s) 10, 226
DinI GGCGCC 1 cut(s) 280
DpnI GATC 1 cut(s) 290
DpnII GATC 1 cut(s) 288
Eam1104I CTCTTC 2 cut(s) 90, 111
EarI CTCTTC 2 cut(s) 90, 111
Eco47I GGWCC 1 cut(s) 258
Eco57I CTGAAG 1 cut(s) 264
EcoRII CCWGG 2 cut(s) 67, 219
EgeI GGCGCC 1 cut(s) 280
EheI GGCGCC 1 cut(s) 280
FaeI CATG 1 cut(s) 26
FaiI YATR 5 cut(s) 24, 45, 54, 152, 285
FatI CATG 1 cut(s) 22
FokI GGATG 2 cut(s) 92, 137
FspBI CTAG 2 cut(s) 210, 252
GlaI GCGC 1 cut(s) 280
GsuI CTGGAG 1 cut(s) 242
HaeII RGCGCY 1 cut(s) 282
HhaI GCGC 1 cut(s) 281
Hin1I GRCGYC 1 cut(s) 279
Hin1II CATG 1 cut(s) 26
Hin6I GCGC 1 cut(s) 279
HinP1I GCGC 1 cut(s) 279
HincII GTYRAC 1 cut(s) 207
HindII GTYRAC 1 cut(s) 207
HphI GGTGA 2 cut(s) 83, 148
Hpy166II GTNNAC 2 cut(s) 88, 207
Hpy8I GTNNAC 2 cut(s) 88, 207
HpyAV CCTTC 1 cut(s) 249
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4IV ACGT 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 12
Hsp92I GRCGYC 1 cut(s) 279
Hsp92II CATG 1 cut(s) 26
HspAI GCGC 1 cut(s) 279
KasI GGCGCC 1 cut(s) 278
Kzo9I GATC 1 cut(s) 288
LguI GCTCTTC 1 cut(s) 90
LmnI GCTCC 1 cut(s) 175
LpnPI CCDG 8 cut(s) 54, 81, 92, 118, 206, 233, 255, 274
MaeI CTAG 2 cut(s) 210, 252
MaeII ACGT 1 cut(s) 12
MalI GATC 1 cut(s) 290
MboI GATC 1 cut(s) 288
MboII GAAGA 4 cut(s) 10, 107, 128, 257
MluCI AATT 2 cut(s) 168, 200
Mly113I GGCGCC 1 cut(s) 279
MnlI CCTC 4 cut(s) 40, 70, 85, 112
MspR9I CCNGG 2 cut(s) 69, 221
MvaI CCWGG 2 cut(s) 69, 221
NarI GGCGCC 1 cut(s) 279
NdeII GATC 1 cut(s) 288
NlaIII CATG 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 280
PciSI GCTCTTC 1 cut(s) 90
PluTI GGCGCC 1 cut(s) 282
Psp6I CCWGG 2 cut(s) 67, 219
PspGI CCWGG 2 cut(s) 67, 219
PspN4I GGNNCC 1 cut(s) 280
PspPI GGNCC 1 cut(s) 258
RsaI GTAC 2 cut(s) 11, 227
RsaNI GTAC 2 cut(s) 10, 226
SapI GCTCTTC 1 cut(s) 90
Sau3AI GATC 1 cut(s) 288
Sau96I GGNCC 1 cut(s) 258
ScaI AGTACT 1 cut(s) 227
ScrFI CCNGG 2 cut(s) 69, 221
SetI ASST 3 cut(s) 15, 123, 253
SfoI GGCGCC 1 cut(s) 280
SinI GGWCC 1 cut(s) 258
SpeI ACTAGT 1 cut(s) 209
Sse9I AATT 2 cut(s) 168, 200
SspDI GGCGCC 1 cut(s) 278
SspI AATATT 1 cut(s) 156
SspMI CTAG 2 cut(s) 210, 252
StyD4I CCNGG 2 cut(s) 67, 219
TaaI ACNGT 1 cut(s) 29
TaiI ACGT 1 cut(s) 15
TasI AATT 2 cut(s) 168, 200
TatI WGTACW 1 cut(s) 225
TspGWI ACGGA 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 258
XspI CTAG 2 cut(s) 210, 252
ZrmI AGTACT 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.