FvH4_4g08482

AAA domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0001352
Physical Location & Seq
Reverse (-)
8520364 .. 8520643
280 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g08482.t1

Sequence Viewer

Length: 201 bp
ATGTTTCCTTCTATCCATTTTTATGAGAAGAAGTTGATGAATGGCTATGATATGTCTAGCAAATCGGCAACATTTCATGAGAACGGTATCACCAAGTTTGTTAAGGTGCCAGAGAAGTGGTTTATGGATGTAATGAATATGAACTCGAGGACTATGATTGGAGAAATGAAATGCAAGAACGGGCAAGTGAAGAGAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA_11 AAA_12 SEN1_N

Protein Analysis

67

Amino Acids

7.81

Weight (kDa)

9.72

Isoelectric Point (pI)

33.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 106
Ama87I CYCGRG 1 cut(s) 145
AsuHPI GGTGA 1 cut(s) 82
AvaI CYCGRG 1 cut(s) 145
BanI GGYRCC 1 cut(s) 106
BfaI CTAG 1 cut(s) 57
BmeT110I CYCGRG 1 cut(s) 145
BmiI GGNNCC 1 cut(s) 108
BseGI GGATG 1 cut(s) 133
BshNI GGYRCC 1 cut(s) 106
BsiHKCI CYCGRG 1 cut(s) 145
BsoBI CYCGRG 1 cut(s) 145
BspHI TCATGA 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 108
BspT107I GGYRCC 1 cut(s) 106
Bst4CI ACNGT 1 cut(s) 86
Bst6I CTCTTC 1 cut(s) 185
BstF5I GGATG 1 cut(s) 133
BstXI CCANNNNNNTGG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 133
CciI TCATGA 1 cut(s) 76
CviAII CATG 1 cut(s) 77
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
Eco88I CYCGRG 1 cut(s) 145
FaeI CATG 1 cut(s) 80
FaiI YATR 7 cut(s) 24, 48, 53, 78, 125, 140, 155
FatI CATG 1 cut(s) 76
FokI GGATG 1 cut(s) 140
FspBI CTAG 1 cut(s) 57
Hin1II CATG 1 cut(s) 80
HphI GGTGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 174
Hsp92II CATG 1 cut(s) 80
LpnPI CCDG 1 cut(s) 123
MaeI CTAG 1 cut(s) 57
MboII GAAGA 1 cut(s) 40
MnlI CCTC 1 cut(s) 141
MseI TTAA 1 cut(s) 102
MslI CAYNNNNRTG 1 cut(s) 21
NlaIII CATG 1 cut(s) 80
NlaIV GGNNCC 1 cut(s) 108
PaeR7I CTCGAG 1 cut(s) 145
PagI TCATGA 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 108
PspXI VCTCGAGB 1 cut(s) 145
RseI CAYNNNNRTG 1 cut(s) 21
SaqAI TTAA 1 cut(s) 102
SetI ASST 1 cut(s) 108
Sfr274I CTCGAG 1 cut(s) 145
SgeI CNNG 9 cut(s) 69, 89, 106, 122, 157, 159, 187, 193, 197
SlaI CTCGAG 1 cut(s) 145
SmiMI CAYNNNNRTG 1 cut(s) 21
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 86
TaqI TCGA 1 cut(s) 146
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspDTI ATGAA 5 cut(s) 53, 65, 149, 155, 182
XhoI CTCGAG 1 cut(s) 145
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.