Rh2AG281200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001352
Physical Location & Seq
Reverse (-)
34161009 .. 34161266
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG281200.1

Sequence Viewer

Length: 258 bp
ATGGAGGGCAAAGACCTGTTTTTGAAGCTGGCACAGTACCGGGTGCGGGTCAATCTTAACGATTCTGATCGGCAAAAGGCTGAGGAACGTACCCACCTCTTCATCAAAAGATTCCCTGAGTGGCAACGGAAAGCGATAATCCTTGGCATCGTCAGGACTACGAGAAGCCTCCTTAGACCTAGGTATATAGATGAGGAGCTTATTCGAAAATTTATTGAAAAAATGAAGGGAGTGGAAGAAGCTGGTGGTGAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

10.13

Weight (kDa)

9.81

Isoelectric Point (pI)

41.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 209
AfaI GTAC 2 cut(s) 38, 91
AfiI CCNNNNNNNGG 1 cut(s) 46
AgsI TTSAA 2 cut(s) 25, 218
AluBI AGCT 3 cut(s) 28, 199, 242
AluI AGCT 3 cut(s) 28, 199, 242
ApoI RAATTY 1 cut(s) 209
AspA2I CCTAGG 1 cut(s) 179
AsuC2I CCSGG 1 cut(s) 41
AsuII TTCGAA 1 cut(s) 205
AvrII CCTAGG 1 cut(s) 179
BbvCI CCTCAGC 1 cut(s) 81
BcnI CCSGG 1 cut(s) 41
BfaI CTAG 1 cut(s) 180
BlnI CCTAGG 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BmsI GCATC 1 cut(s) 156
Bpu10I CCTNAGC 1 cut(s) 81
Bpu14I TTCGAA 1 cut(s) 205
BpuMI CCSGG 1 cut(s) 41
BsaBI GATNNNNATC 1 cut(s) 66
BsaJI CCNNGG 2 cut(s) 142, 179
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse8I GATNNNNATC 1 cut(s) 66
BseDI CCNNGG 2 cut(s) 142, 179
BseJI GATNNNNATC 1 cut(s) 66
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMII CTCAG 2 cut(s) 72, 108
BseRI GAGGAG 1 cut(s) 209
BsiSI CCGG 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 46
Bsp119I TTCGAA 1 cut(s) 205
Bsp143I GATC 1 cut(s) 67
BspACI CCGC 1 cut(s) 46
BspCNI CTCAG 2 cut(s) 73, 109
BspT104I TTCGAA 1 cut(s) 205
BssECI CCNNGG 2 cut(s) 142, 179
BssMI GATC 1 cut(s) 67
BssT1I CCWWGG 2 cut(s) 142, 179
Bst4CI ACNGT 1 cut(s) 36
Bst6I CTCTTC 1 cut(s) 104
BstBI TTCGAA 1 cut(s) 205
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 3 cut(s) 81, 117, 173
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 39
Cac8I GCNNGC 1 cut(s) 30
Csp6I GTAC 2 cut(s) 37, 90
CviJI RGCY 5 cut(s) 28, 80, 168, 199, 242
CviKI_1 RGCY 5 cut(s) 28, 80, 168, 199, 242
CviQI GTAC 2 cut(s) 37, 90
DdeI CTNAG 3 cut(s) 81, 117, 173
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
Eco130I CCWWGG 2 cut(s) 142, 179
EcoT14I CCWWGG 2 cut(s) 142, 179
ErhI CCWWGG 2 cut(s) 142, 179
FaiI YATR 2 cut(s) 186, 188
FauI CCCGC 1 cut(s) 39
FspBI CTAG 1 cut(s) 180
HapII CCGG 1 cut(s) 40
HinfI GANTC 2 cut(s) 62, 111
HpaII CCGG 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 154
HpyAV CCTTC 2 cut(s) 220, 245
HpyCH4III ACNGT 1 cut(s) 36
HpyCH4IV ACGT 1 cut(s) 88
HpyF3I CTNAG 3 cut(s) 81, 117, 173
HpySE526I ACGT 1 cut(s) 88
Kzo9I GATC 1 cut(s) 67
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 6 cut(s) 14, 29, 53, 129, 139, 228
LweI GCATC 1 cut(s) 156
MaeI CTAG 1 cut(s) 180
MaeII ACGT 1 cut(s) 88
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 2 cut(s) 91, 248
MluCI AATT 1 cut(s) 209
MnlI CCTC 4 cut(s) 76, 107, 179, 187
MseI TTAA 1 cut(s) 57
MspI CCGG 1 cut(s) 40
MspR9I CCNGG 1 cut(s) 41
NciI CCSGG 1 cut(s) 41
NdeII GATC 1 cut(s) 67
NspV TTCGAA 1 cut(s) 205
PfeI GAWTC 2 cut(s) 62, 111
RsaI GTAC 2 cut(s) 38, 91
RsaNI GTAC 2 cut(s) 37, 90
SaqAI TTAA 1 cut(s) 57
Sau3AI GATC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 41
SetI ASST 8 cut(s) 18, 30, 91, 99, 181, 185, 201, 244
SfaNI GCATC 1 cut(s) 156
SfuI TTCGAA 1 cut(s) 205
Sse9I AATT 1 cut(s) 209
SsiI CCGC 1 cut(s) 46
SspMI CTAG 1 cut(s) 180
StyD4I CCNGG 1 cut(s) 39
StyI CCWWGG 2 cut(s) 142, 179
TaaI ACNGT 1 cut(s) 36
TaiI ACGT 1 cut(s) 91
TaqI TCGA 1 cut(s) 205
TasI AATT 1 cut(s) 209
TfiI GAWTC 2 cut(s) 62, 111
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TspDTI ATGAA 2 cut(s) 91, 239
TspGWI ACGGA 1 cut(s) 142
XapI RAATTY 1 cut(s) 209
XmaJI CCTAGG 1 cut(s) 179
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.