Rh2CG329800

endonuclease activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001352
Physical Location & Seq
Forward (+)
43039473 .. 43039811
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG329800.1

Sequence Viewer

Length: 339 bp
ATGCTGGTTGCAATGAAAAGGCTGAAACCTCTTAACATATGTGGGGATGACAAAAGCAAAGGAGCTACAGAGAATTTTTCCACAGATCCTGCAAGTAATTTGGAATCTGTCAGTTTTCTATCTGAACTCCAAGTTAATCCTGTAACCAATCTACATGAAAGTGGTGATGCTGCTGGTGATTGTGAGAAGGATAAAACCAAAAAGAGTGATATAATTGGGTATGATGGTGATCATGAGAAAGCTGAAAAGTATGCATCATCTAGAGACATTAGTAAAAGCTCTACAGAAAAAACCTTTGCGGAAGACTCTACTAAAGAAGAACAAAGAGACCATTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.3

Weight (kDa)

4.92

Isoelectric Point (pI)

40.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 299
AclWI GGATC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 73
AluBI AGCT 3 cut(s) 65, 242, 279
AluI AGCT 3 cut(s) 65, 242, 279
Alw26I GTCTC 2 cut(s) 258, 321
AlwI GGATC 1 cut(s) 80
AlwNI CAGNNNCTG 1 cut(s) 89
ApeKI GCWGC 1 cut(s) 170
ApoI RAATTY 1 cut(s) 73
AsuHPI GGTGA 3 cut(s) 176, 188, 239
BbsI GAAGAC 1 cut(s) 309
BbvI GCAGC 1 cut(s) 157
BccI CCATC 1 cut(s) 218
BclI TGATCA 1 cut(s) 229
BcoDI GTCTC 2 cut(s) 258, 321
BfaI CTAG 1 cut(s) 261
BfmI CTRYAG 2 cut(s) 66, 282
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
BmsI GCATC 2 cut(s) 157, 263
BpiI GAAGAC 1 cut(s) 309
BsaBI GATNNNNATC 1 cut(s) 228
BsaI GGTCTC 1 cut(s) 321
Bse3DI GCAATG 2 cut(s) 18, 331
Bse8I GATNNNNATC 1 cut(s) 228
BseGI GGATG 1 cut(s) 52
BseJI GATNNNNATC 1 cut(s) 228
BseMI GCAATG 2 cut(s) 18, 331
BseXI GCAGC 1 cut(s) 157
BsmAI GTCTC 2 cut(s) 258, 321
Bso31I GGTCTC 1 cut(s) 321
Bsp143I GATC 2 cut(s) 85, 229
BspACI CCGC 1 cut(s) 299
BspHI TCATGA 1 cut(s) 232
BspPI GGATC 1 cut(s) 80
BspTNI GGTCTC 1 cut(s) 321
BsrDI GCAATG 2 cut(s) 18, 331
BssMI GATC 2 cut(s) 85, 229
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 2 cut(s) 88, 232
BstMAI GTCTC 2 cut(s) 258, 321
BstMBI GATC 2 cut(s) 85, 229
BstSFI CTRYAG 2 cut(s) 66, 282
BstV1I GCAGC 1 cut(s) 157
BstV2I GAAGAC 1 cut(s) 309
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BtsCI GGATG 1 cut(s) 52
CaiI CAGNNNCTG 1 cut(s) 89
CciI TCATGA 1 cut(s) 232
CviAII CATG 2 cut(s) 155, 233
CviJI RGCY 4 cut(s) 22, 65, 242, 279
CviKI_1 RGCY 4 cut(s) 22, 65, 242, 279
DpnI GATC 2 cut(s) 87, 231
DpnII GATC 2 cut(s) 85, 229
Eco31I GGTCTC 1 cut(s) 321
EcoT22I ATGCAT 1 cut(s) 256
FaeI CATG 2 cut(s) 158, 236
FaiI YATR 7 cut(s) 38, 40, 156, 212, 222, 234, 252
FatI CATG 2 cut(s) 154, 232
FauNDI CATATG 1 cut(s) 38
FbaI TGATCA 1 cut(s) 229
Fnu4HI GCNGC 1 cut(s) 171
FokI GGATG 1 cut(s) 59
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 1 cut(s) 261
GluI GCNGC 1 cut(s) 171
Hin1II CATG 2 cut(s) 158, 236
HinfI GANTC 2 cut(s) 104, 305
HphI GGTGA 3 cut(s) 176, 188, 239
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 233, 261
HpyAV CCTTC 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 11, 92, 254
Hsp92II CATG 2 cut(s) 158, 236
Ksp22I TGATCA 1 cut(s) 229
Kzo9I GATC 2 cut(s) 85, 229
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 3 cut(s) 102, 153, 159
Lsp1109I GCAGC 1 cut(s) 157
LweI GCATC 2 cut(s) 157, 263
MaeI CTAG 1 cut(s) 261
MaeIII GTNAC 1 cut(s) 142
MalI GATC 2 cut(s) 87, 231
MboI GATC 2 cut(s) 85, 229
MboII GAAGA 2 cut(s) 314, 329
MflI RGATCY 1 cut(s) 85
MluCI AATT 3 cut(s) 73, 97, 213
MlyI GAGTC 1 cut(s) 299
MnlI CCTC 1 cut(s) 39
Mph1103I ATGCAT 1 cut(s) 256
MseI TTAA 2 cut(s) 33, 135
MslI CAYNNNNRTG 1 cut(s) 159
NdeI CATATG 1 cut(s) 38
NdeII GATC 2 cut(s) 85, 229
NlaIII CATG 2 cut(s) 158, 236
NsiI ATGCAT 1 cut(s) 256
PagI TCATGA 1 cut(s) 232
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 1 cut(s) 172
PleI GAGTC 1 cut(s) 299
PpsI GAGTC 1 cut(s) 299
PstNI CAGNNNCTG 1 cut(s) 89
PsuI RGATCY 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 159
SaqAI TTAA 2 cut(s) 33, 135
SatI GCNGC 1 cut(s) 171
Sau3AI GATC 2 cut(s) 85, 229
SchI GAGTC 1 cut(s) 299
SetI ASST 5 cut(s) 31, 67, 244, 281, 296
SfaNI GCATC 2 cut(s) 157, 263
SfcI CTRYAG 2 cut(s) 66, 282
SgeI CNNG 9 cut(s) 17, 101, 105, 143, 152, 167, 186, 245, 273
SmiMI CAYNNNNRTG 1 cut(s) 159
Sse9I AATT 3 cut(s) 73, 97, 213
SsiI CCGC 1 cut(s) 299
SspMI CTAG 1 cut(s) 261
TasI AATT 3 cut(s) 73, 97, 213
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 2 cut(s) 33, 135
Tru9I TTAA 2 cut(s) 33, 135
TseI GCWGC 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 29, 171
XapI RAATTY 1 cut(s) 73
XbaI TCTAGA 1 cut(s) 260
XspI CTAG 1 cut(s) 261
Zsp2I ATGCAT 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.