Rmu_sc0008096.1_g000007

endonuclease activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008096.1
OG0001352
Physical Location & Seq
Reverse (-)
18769 .. 19677
909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008096.1_g000007.1.cds

Sequence Viewer

Length: 909 bp
atgcctggtgttgccaataatgctgtgattcctaatatgcatgatttcattcattataatatctcacctgccacttctactgtgaatcactacaatgctccatctcctagctttactacacactttgggttatcacaggacagtgcaatgttaagtacaactttcaatatgcctaatgcatctgcaaattgtcaagtcatgccctcaatttctatcagtaatggtgcacctcaatcaatttctaactctggatatgtgatgagtaatgggtcactcgatggtactcgacagctacaatcacaagtatacaatcctgcatatggtgatagttgttttcagcaaaatggaggcatttcacaacagcaaagtggtggtggttttcagcaaaacaatggtcttcaacctattggtaacctattatacagtggatctaaatctcaaggtcaagctcaactcaatttcagtaaaggttactcaaaatcaaaaggtggtgtgtcacaacacaatgtgagttcttatcacaaatcaagaaaatctaactcaggtgacggattttatatgcatattccaccaattcatgttccccctgaagaagaacctgttgcacatgtgaatacttttgttgatactgctgaaaagaagatggataatacagatagaaatcagtctctcaatactgataaatggataaatagtcataatgcgaaggaggcagagaatacaaatgtacttgtgccttatgtgcctaatgacatacatgtggtagaagatcctgtgctgatgcttgaagatttcagaaaccgcaaaggaaatcaattagaccaattcacttccttggactattgggaacagtttgatgctaaggaaaatgatgacaaacattctggtttcaacgagaatttgaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

302

Amino Acids

33.18

Weight (kDa)

5.56

Isoelectric Point (pI)

60.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AarI CACCTGC 1 cut(s) 76
Acc36I ACCTGC 1 cut(s) 76
AccI GTMKAC 1 cut(s) 306
AciI CCGC 1 cut(s) 802
AclWI GGATC 2 cut(s) 436, 764
AcsI RAATTY 1 cut(s) 898
AcuI CTGAAG 1 cut(s) 609
AdeI CACNNNGTG 1 cut(s) 508
AfaI GTAC 3 cut(s) 157, 283, 729
AfiI CCNNNNNNNGG 1 cut(s) 320
AflIII ACRYGT 2 cut(s) 607, 757
AgsI TTSAA 5 cut(s) 166, 401, 788, 892, 904
AjnI CCWGG 1 cut(s) 4
AluBI AGCT 3 cut(s) 111, 292, 449
AluI AGCT 3 cut(s) 111, 292, 449
Alw21I GWGCWC 1 cut(s) 229
Alw26I GTCTC 1 cut(s) 672
Alw44I GTGCAC 1 cut(s) 225
AlwI GGATC 2 cut(s) 436, 764
ApaLI GTGCAC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 898
ArsI GACNNNNNNTTYG 2 cut(s) 379, 411
AsuHPI GGTGA 3 cut(s) 57, 335, 557
BaeGI GKGCMC 1 cut(s) 229
BbsI GAAGAC 1 cut(s) 389
Bbv12I GWGCWC 1 cut(s) 229
BccI CCATC 3 cut(s) 109, 272, 637
BciT130I CCWGG 1 cut(s) 6
BcoDI GTCTC 1 cut(s) 672
BfaI CTAG 1 cut(s) 108
BfuAI ACCTGC 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BmsI GCATC 3 cut(s) 188, 771, 847
BpiI GAAGAC 1 cut(s) 389
Bpu10I CCTNAGC 1 cut(s) 861
BpuEI CTTGAG 1 cut(s) 423
BsaBI GATNNNNATC 2 cut(s) 433, 660
BsaJI CCNNGG 1 cut(s) 834
Bsc4I CCNNNNNNNGG 1 cut(s) 320
Bse3DI GCAATG 1 cut(s) 153
Bse8I GATNNNNATC 2 cut(s) 433, 660
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 834
BseJI GATNNNNATC 2 cut(s) 433, 660
BseLI CCNNNNNNNGG 1 cut(s) 320
BseMI GCAATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 555
BseSI GKGCMC 1 cut(s) 229
BsiHKAI GWGCWC 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 320
BsmAI GTCTC 1 cut(s) 672
Bsp1286I GDGCHC 1 cut(s) 229
Bsp143I GATC 2 cut(s) 428, 769
BspACI CCGC 1 cut(s) 802
BspCNI CTCAG 1 cut(s) 554
BspMI ACCTGC 1 cut(s) 76
BspPI GGATC 2 cut(s) 436, 764
BsrDI GCAATG 1 cut(s) 153
BssECI CCNNGG 1 cut(s) 834
BssMI GATC 2 cut(s) 428, 769
BssNAI GTATAC 1 cut(s) 307
BssT1I CCWWGG 1 cut(s) 834
Bst1107I GTATAC 1 cut(s) 307
Bst2UI CCWGG 1 cut(s) 6
Bst4CI ACNGT 4 cut(s) 82, 143, 425, 852
BstDEI CTNAG 2 cut(s) 541, 861
BstEII GGTNACC 1 cut(s) 410
BstKTI GATC 2 cut(s) 431, 772
BstMAI GTCTC 1 cut(s) 672
BstMBI GATC 2 cut(s) 428, 769
BstMWI GCNNNNNNNGC 3 cut(s) 20, 710, 742
BstNI CCWGG 1 cut(s) 6
BstNSI RCATGY 2 cut(s) 611, 761
BstPI GGTNACC 1 cut(s) 410
BstSCI CCNGG 1 cut(s) 4
BstSLI GKGCMC 1 cut(s) 229
BstV2I GAAGAC 1 cut(s) 389
BstX2I RGATCY 2 cut(s) 428, 769
BstYI RGATCY 2 cut(s) 428, 769
BstZ17I GTATAC 1 cut(s) 307
BtsIMutI CAGTG 2 cut(s) 148, 430
BveI ACCTGC 1 cut(s) 76
Csp6I GTAC 3 cut(s) 156, 282, 728
CviAII CATG 5 cut(s) 41, 199, 578, 608, 758
CviJI RGCY 3 cut(s) 111, 292, 449
CviKI_1 RGCY 3 cut(s) 111, 292, 449
CviQI GTAC 3 cut(s) 156, 282, 728
DdeI CTNAG 2 cut(s) 541, 861
DpnI GATC 2 cut(s) 430, 771
DpnII GATC 2 cut(s) 428, 769
DraIII CACNNNGTG 1 cut(s) 508
Eco130I CCWWGG 1 cut(s) 834
Eco57I CTGAAG 1 cut(s) 609
Eco91I GGTNACC 1 cut(s) 410
EcoO65I GGTNACC 1 cut(s) 410
EcoRII CCWGG 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 834
EcoT22I ATGCAT 3 cut(s) 42, 181, 564
ErhI CCWWGG 1 cut(s) 834
FaeI CATG 5 cut(s) 44, 202, 581, 611, 761
FalI AAGNNNNNCTT 2 cut(s) 145, 177
FatI CATG 5 cut(s) 40, 198, 577, 607, 757
FauNDI CATATG 1 cut(s) 319
FblI GTMKAC 1 cut(s) 306
FspBI CTAG 1 cut(s) 108
Hin1II CATG 5 cut(s) 44, 202, 581, 611, 761
HinfI GANTC 2 cut(s) 28, 85
HphI GGTGA 3 cut(s) 57, 335, 557
Hpy166II GTNNAC 2 cut(s) 227, 307
Hpy188I TCNGA 1 cut(s) 797
Hpy188III TCNNGA 2 cut(s) 249, 528
Hpy8I GTNNAC 2 cut(s) 227, 307
HpyAV CCTTC 1 cut(s) 700
HpyCH4III ACNGT 4 cut(s) 82, 143, 425, 852
HpyCH4V TGCA 8 cut(s) 40, 146, 179, 185, 227, 317, 562, 605
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 710, 742
HpyF3I CTNAG 2 cut(s) 541, 861
Hsp92II CATG 5 cut(s) 44, 202, 581, 611, 761
Kzo9I GATC 2 cut(s) 428, 769
LmnI GCTCC 1 cut(s) 103
LweI GCATC 3 cut(s) 188, 771, 847
MaeI CTAG 1 cut(s) 108
MaeIII GTNAC 5 cut(s) 270, 410, 470, 495, 545
MalI GATC 2 cut(s) 430, 771
MboI GATC 2 cut(s) 428, 769
MboII GAAGA 6 cut(s) 389, 602, 605, 652, 779, 800
MflI RGATCY 2 cut(s) 428, 769
MhlI GDGCHC 1 cut(s) 229
MluCI AATT 8 cut(s) 187, 207, 237, 457, 573, 815, 824, 898
MnlI CCTC 4 cut(s) 214, 240, 341, 703
Mph1103I ATGCAT 3 cut(s) 42, 181, 564
MseI TTAA 1 cut(s) 152
MslI CAYNNNNRTG 2 cut(s) 93, 758
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
MwoI GCNNNNNNNGC 3 cut(s) 20, 710, 742
NdeI CATATG 1 cut(s) 319
NdeII GATC 2 cut(s) 428, 769
NlaIII CATG 5 cut(s) 44, 202, 581, 611, 761
NmuCI GTSAC 3 cut(s) 270, 495, 545
NsiI ATGCAT 3 cut(s) 42, 181, 564
NspI RCATGY 2 cut(s) 611, 761
PaqCI CACCTGC 1 cut(s) 76
PciI ACATGT 2 cut(s) 607, 757
PfeI GAWTC 2 cut(s) 28, 85
PscI ACATGT 2 cut(s) 607, 757
PsiI TTATAA 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 4
PspEI GGTNACC 1 cut(s) 410
PspGI CCWGG 1 cut(s) 4
PsuI RGATCY 2 cut(s) 428, 769
RsaI GTAC 3 cut(s) 157, 283, 729
RsaNI GTAC 3 cut(s) 156, 282, 728
RseI CAYNNNNRTG 2 cut(s) 93, 758
SaqAI TTAA 1 cut(s) 152
Sau3AI GATC 2 cut(s) 428, 769
ScrFI CCNGG 1 cut(s) 6
SduI GDGCHC 1 cut(s) 229
SfaNI GCATC 3 cut(s) 188, 771, 847
SmiMI CAYNNNNRTG 2 cut(s) 93, 758
SmlI CTYRAG 1 cut(s) 438
SmoI CTYRAG 1 cut(s) 438
Sse9I AATT 8 cut(s) 187, 207, 237, 457, 573, 815, 824, 898
SsiI CCGC 1 cut(s) 802
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 4
StyI CCWWGG 1 cut(s) 834
TaaI ACNGT 4 cut(s) 82, 143, 425, 852
TaqI TCGA 2 cut(s) 276, 286
TasI AATT 8 cut(s) 187, 207, 237, 457, 573, 815, 824, 898
TatI WGTACW 2 cut(s) 155, 727
TfiI GAWTC 2 cut(s) 28, 85
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
TscAI CASTG 2 cut(s) 148, 430
TseFI GTSAC 3 cut(s) 270, 495, 545
Tsp45I GTSAC 3 cut(s) 270, 495, 545
TspDTI ATGAA 3 cut(s) 37, 41, 566
TspGWI ACGGA 1 cut(s) 564
TspRI CASTG 2 cut(s) 148, 430
VneI GTGCAC 1 cut(s) 225
XapI RAATTY 1 cut(s) 898
XceI RCATGY 2 cut(s) 611, 761
XmiI GTMKAC 1 cut(s) 306
XspI CTAG 1 cut(s) 108
Zsp2I ATGCAT 3 cut(s) 42, 181, 564
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.