FvH4_4g15804

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000370
Physical Location & Seq
Reverse (-)
19699251 .. 19699621
371 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g15804.t1

Sequence Viewer

Length: 267 bp
ATGAAAACAAACGCAGCTGGATTTAAGGTGAGTATTATCTCACCAAGGTCCACTTTGGGACCAAATATTTATAATTATTATGATGATGATTATGATGTTGATTTTGATGATGATGATGATGATAATTGTTATGATGATAATTTTGATGATGATGAGATTAATGATGATGATGATAATGTTGATGGAAATGTTGATGATATGATGATTATGATGACGATGGTAATGGTTTTGATGATAATTATGATGTTATTGTTATATTGTGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.21

Weight (kDa)

4.05

Isoelectric Point (pI)

23.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000370)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29481 FvH4_2g11454 FvH4_3g19661 FvH4_3g28463 FvH4_3g31691 FvH4_3g34551 FvH4_3g35241 FvH4_4g06575 FvH4_4g09082 FvH4_4g15804 FvH4_4g15805 FvH4_4g16178 FvH4_4g16282 FvH4_5g25163 FvH4_6g27413 FvH4_7g02962 FvH4_7g04361
malus_domestica MD01G1095000.v1.1 MD02G1270200.v1.1 MD02G1270300.v1.1 MD02G1270400.v1.1 MD06G1059100.v1.1 MD08G1226500.v1.1
prunus_persica Prupe.1G169500_v2.0.a1 Prupe.5G195800_v2.0.a1
pyrus_communis pycom01g00010 pycom01g00770 pycom02g23140 pycom03g11760 pycom04g06090 pycom05g06900 pycom05g08070 pycom05g14500 pycom06g03050 pycom07g06250 pycom07g07540 pycom07g10580 pycom08g04990 pycom1146g00060 pycom11g01080 pycom11g15270 pycom11g15460 pycom11g24900 pycom12419g00150 pycom12424g00120 pycom13g08740 pycom13g24950 pycom13g25960 pycom13g26030 pycom13g27820 pycom16g23270 pycom16g25020 pycom16g25960 pycom17g07780 pycom17g08210 pycom17g13100
rosa_chinensis RchiOBHm_Chr1g0329421 RchiOBHm_Chr4g0397711 RchiOBHm_Chr4g0403481 RchiOBHm_Chr5g0019091 RchiOBHm_Chr5g0049101
rosa_laevigata RLG00000029892
rosa_multiflora Rmu_sc0001866.1_g000007
rosa_roxburghii Rroxscaffold_2G00094160 Rroxscaffold_3G00229110 Rroxscaffold_4G00321100 Rroxscaffold_7G00196040 Rroxscaffold_7G00196280
rosa_rugosa Rorug05G0160500 Rorug06G0096500
rosa_samantha Rh1AG098600 Rh1AG098800 Rh1BG078200 Rh1BG078700 Rh1BG178500 Rh1CG094600 Rh1CG094900 Rh1DG101700 Rh1DG109600 Rh2AG175800 Rh2AG175900 Rh2AG511400 Rh2BG114700 Rh2CG042200 Rh2CG116600 Rh2CG317500 Rh2DG327700 Rh2DG337800 Rh4CG142700 Rh4DG113100 Rh5BG335800 Rh5CG360600 Rh5DG352000 Rh6BG071400 Rh6BG417100 Rh6CG463300 Rh6CG463400 Rh7BG186600 Rh7CG196500 Rh7CG196600 Rh7CG448900 Rh7DG228300
rosa_wichuraiana Rw4G006560 Rw4G017340 Rw5G030450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 72
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 14
AseI ATTAAT 1 cut(s) 159
AspS9I GGNCC 2 cut(s) 48, 59
AsuHPI GGTGA 2 cut(s) 33, 40
AvaII GGWCC 2 cut(s) 48, 59
BbvI GCAGC 1 cut(s) 26
BccI CCATC 2 cut(s) 176, 211
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bme18I GGWCC 2 cut(s) 48, 59
BmgT120I GGNCC 2 cut(s) 48, 59
BmiI GGNNCC 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 26
BslFI GGGAC 1 cut(s) 72
BsmFI GGGAC 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 44
BssT1I CCWWGG 1 cut(s) 44
BstV1I GCAGC 1 cut(s) 26
Cfr13I GGNCC 2 cut(s) 48, 59
CviJI RGCY 1 cut(s) 17
CviKI_1 RGCY 1 cut(s) 17
Eco130I CCWWGG 1 cut(s) 44
Eco47I GGWCC 2 cut(s) 48, 59
EcoT14I CCWWGG 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 44
FaiI YATR 8 cut(s) 72, 81, 93, 132, 200, 209, 242, 256
FalI AAGNNNNNCTT 2 cut(s) 37, 69
FaqI GGGAC 1 cut(s) 72
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 15
HphI GGTGA 2 cut(s) 33, 40
Hpy166II GTNNAC 1 cut(s) 51
Hpy8I GTNNAC 1 cut(s) 51
LpnPI CCDG 1 cut(s) 3
Lsp1109I GCAGC 1 cut(s) 26
MluCI AATT 4 cut(s) 73, 124, 139, 237
MseI TTAA 2 cut(s) 24, 159
MspA1I CMGCKG 1 cut(s) 17
NlaIV GGNNCC 1 cut(s) 60
PkrI GCNGC 1 cut(s) 16
PshBI ATTAAT 1 cut(s) 159
PsiI TTATAA 1 cut(s) 72
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 2 cut(s) 48, 59
PvuII CAGCTG 1 cut(s) 17
SaqAI TTAA 2 cut(s) 24, 159
SatI GCNGC 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 48, 59
SetI ASST 3 cut(s) 19, 30, 50
SgeI CNNG 2 cut(s) 30, 57
SinI GGWCC 2 cut(s) 48, 59
Sse9I AATT 4 cut(s) 73, 124, 139, 237
SspI AATATT 1 cut(s) 67
StyI CCWWGG 1 cut(s) 44
TasI AATT 4 cut(s) 73, 124, 139, 237
Tru1I TTAA 2 cut(s) 24, 159
Tru9I TTAA 2 cut(s) 24, 159
TseI GCWGC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 48, 59
VspI ATTAAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.