Rh6CG463300

Retrotransposon gag protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
63646304 .. 63646639
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG463300.1

Sequence Viewer

Length: 336 bp
ATGCCAAACACTGAAATCACCACCTGGACTGCATTTGAGAACATTTTCTTGGAAAAATATTTTCTAGACACTGTGAGAGGAATGAAAGTTCGAGAATTTATAAATCTTCTTCAGCGTGACCTATCTGTGGCTGAATACCAGGCTAAGTTAGAAGAACTTATGCGATTTGCACCAACCATGATTTCAACTGAACTTACCAAAGCAAAACGATTCCAGGATGGTCTTAGGCCTACTATTAAGGAAAAGGTGTCAATTCTCAGACTGGAAAGGTATGCAGATGTGGTGGATCGAACACTTATAGCTGAACAGAATCTAAATGAGACTAAGAAAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

13.12

Weight (kDa)

7.95

Isoelectric Point (pI)

32.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 5 - 77 1.7e-10 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000370)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29481 FvH4_2g11454 FvH4_3g19661 FvH4_3g28463 FvH4_3g31691 FvH4_3g34551 FvH4_3g35241 FvH4_4g06575 FvH4_4g09082 FvH4_4g15804 FvH4_4g15805 FvH4_4g16178 FvH4_4g16282 FvH4_5g25163 FvH4_6g27413 FvH4_7g02962 FvH4_7g04361
malus_domestica MD01G1095000.v1.1 MD02G1270200.v1.1 MD02G1270300.v1.1 MD02G1270400.v1.1 MD06G1059100.v1.1 MD08G1226500.v1.1
prunus_persica Prupe.1G169500_v2.0.a1 Prupe.5G195800_v2.0.a1
pyrus_communis pycom01g00010 pycom01g00770 pycom02g23140 pycom03g11760 pycom04g06090 pycom05g06900 pycom05g08070 pycom05g14500 pycom06g03050 pycom07g06250 pycom07g07540 pycom07g10580 pycom08g04990 pycom1146g00060 pycom11g01080 pycom11g15270 pycom11g15460 pycom11g24900 pycom12419g00150 pycom12424g00120 pycom13g08740 pycom13g24950 pycom13g25960 pycom13g26030 pycom13g27820 pycom16g23270 pycom16g25020 pycom16g25960 pycom17g07780 pycom17g08210 pycom17g13100
rosa_chinensis RchiOBHm_Chr1g0329421 RchiOBHm_Chr4g0397711 RchiOBHm_Chr4g0403481 RchiOBHm_Chr5g0019091 RchiOBHm_Chr5g0049101
rosa_laevigata RLG00000029892
rosa_multiflora Rmu_sc0001866.1_g000007
rosa_roxburghii Rroxscaffold_2G00094160 Rroxscaffold_3G00229110 Rroxscaffold_4G00321100 Rroxscaffold_7G00196040 Rroxscaffold_7G00196280
rosa_rugosa Rorug05G0160500 Rorug06G0096500
rosa_samantha Rh1AG098600 Rh1AG098800 Rh1BG078200 Rh1BG078700 Rh1BG178500 Rh1CG094600 Rh1CG094900 Rh1DG101700 Rh1DG109600 Rh2AG175800 Rh2AG175900 Rh2AG511400 Rh2BG114700 Rh2CG042200 Rh2CG116600 Rh2CG317500 Rh2DG327700 Rh2DG337800 Rh4CG142700 Rh4DG113100 Rh5BG335800 Rh5CG360600 Rh5DG352000 Rh6BG071400 Rh6BG417100 Rh6CG463300 Rh6CG463400 Rh7BG186600 Rh7CG196500 Rh7CG196600 Rh7CG448900 Rh7DG228300
rosa_wichuraiana Rw4G006560 Rw4G017340 Rw5G030450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 101
AclWI GGATC 1 cut(s) 294
AcsI RAATTY 1 cut(s) 95
AcuI CTGAAG 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 127
AgsI TTSAA 1 cut(s) 186
AjnI CCWGG 3 cut(s) 23, 138, 213
AjuI GAANNNNNNNTTGG 4 cut(s) 32, 64, 166, 198
AloI GAACNNNNNNTCC 2 cut(s) 72, 104
AluBI AGCT 1 cut(s) 302
AluI AGCT 1 cut(s) 302
Alw26I GTCTC 1 cut(s) 314
AlwI GGATC 1 cut(s) 294
AoxI GGCC 1 cut(s) 227
ApoI RAATTY 1 cut(s) 95
Asp700I GAANNNNTTC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 10
BccI CCATC 1 cut(s) 212
BciT130I CCWGG 3 cut(s) 25, 140, 215
BcoDI GTCTC 1 cut(s) 314
BfaI CTAG 2 cut(s) 65, 334
Bme1390I CCNGG 3 cut(s) 25, 140, 215
BmrFI CCNGG 3 cut(s) 25, 140, 215
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse1I ACTGG 1 cut(s) 267
BseBI CCWGG 3 cut(s) 25, 140, 215
BseGI GGATG 1 cut(s) 223
BseLI CCNNNNNNNGG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 271
BseNI ACTGG 1 cut(s) 267
BshFI GGCC 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 314
BsnI GGCC 1 cut(s) 229
Bsp143I GATC 1 cut(s) 286
BspANI GGCC 1 cut(s) 229
BspCNI CTCAG 1 cut(s) 270
BspPI GGATC 1 cut(s) 294
BsrI ACTGG 1 cut(s) 267
BssMI GATC 1 cut(s) 286
Bst2UI CCWGG 3 cut(s) 25, 140, 215
Bst4CI ACNGT 1 cut(s) 73
BstDEI CTNAG 4 cut(s) 144, 224, 257, 324
BstF5I GGATG 1 cut(s) 223
BstKTI GATC 1 cut(s) 289
BstMAI GTCTC 1 cut(s) 314
BstMBI GATC 1 cut(s) 286
BstNI CCWGG 3 cut(s) 25, 140, 215
BstSCI CCNGG 3 cut(s) 23, 138, 213
BsuRI GGCC 1 cut(s) 229
BtsCI GGATG 1 cut(s) 223
BtsIMutI CAGTG 2 cut(s) 9, 69
CviAII CATG 1 cut(s) 178
CviJI RGCY 4 cut(s) 131, 143, 229, 302
CviKI_1 RGCY 4 cut(s) 131, 143, 229, 302
DdeI CTNAG 4 cut(s) 144, 224, 257, 324
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
Eco147I AGGCCT 1 cut(s) 229
Eco57I CTGAAG 1 cut(s) 95
EcoRII CCWGG 3 cut(s) 23, 138, 213
FaeI CATG 1 cut(s) 181
FaiI YATR 5 cut(s) 101, 161, 179, 273, 299
FatI CATG 1 cut(s) 177
FokI GGATG 1 cut(s) 230
FspBI CTAG 2 cut(s) 65, 334
HaeIII GGCC 1 cut(s) 229
Hin1II CATG 1 cut(s) 181
HinfI GANTC 2 cut(s) 210, 310
HphI GGTGA 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 260
Hpy188III TCNNGA 2 cut(s) 65, 92
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 3 cut(s) 32, 170, 275
HpyF3I CTNAG 4 cut(s) 144, 224, 257, 324
Hsp92II CATG 1 cut(s) 181
Kzo9I GATC 1 cut(s) 286
LpnPI CCDG 7 cut(s) 10, 37, 125, 152, 200, 227, 248
MaeI CTAG 2 cut(s) 65, 334
MaeIII GTNAC 1 cut(s) 116
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 3 cut(s) 98, 101, 164
MluCI AATT 2 cut(s) 95, 252
MnlI CCTC 1 cut(s) 71
MroXI GAANNNNTTC 1 cut(s) 44
MseI TTAA 1 cut(s) 237
MspR9I CCNGG 3 cut(s) 25, 140, 215
MvaI CCWGG 3 cut(s) 25, 140, 215
NdeII GATC 1 cut(s) 286
NlaIII CATG 1 cut(s) 181
NmuCI GTSAC 1 cut(s) 116
PceI AGGCCT 1 cut(s) 229
PdmI GAANNNNTTC 1 cut(s) 44
PfeI GAWTC 2 cut(s) 210, 310
PfoI TCCNGGA 1 cut(s) 213
PsiI TTATAA 1 cut(s) 101
Psp6I CCWGG 3 cut(s) 23, 138, 213
PspGI CCWGG 3 cut(s) 23, 138, 213
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 1 cut(s) 286
ScrFI CCNGG 3 cut(s) 25, 140, 215
SetI ASST 5 cut(s) 26, 123, 249, 272, 304
Sse9I AATT 2 cut(s) 95, 252
SseBI AGGCCT 1 cut(s) 229
SspI AATATT 1 cut(s) 59
SspMI CTAG 2 cut(s) 65, 334
StuI AGGCCT 1 cut(s) 229
StyD4I CCNGG 3 cut(s) 23, 138, 213
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 2 cut(s) 91, 289
TasI AATT 2 cut(s) 95, 252
TfiI GAWTC 2 cut(s) 210, 310
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 2 cut(s) 16, 76
TseFI GTSAC 1 cut(s) 116
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 98
TspRI CASTG 2 cut(s) 16, 76
XapI RAATTY 1 cut(s) 95
XbaI TCTAGA 1 cut(s) 64
XmnI GAANNNNTTC 1 cut(s) 44
XspI CTAG 2 cut(s) 65, 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.