pycom16g25020

Amidohydrolase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0000370
Physical Location & Seq
Forward (+)
26723756 .. 26724139
384 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g25020.2

Sequence Viewer

Length: 321 bp
ATGGATTGGGATGTCTTCAAACGCCTATTTGAGGCTAGGTTTACACCTCCGAAGTACAAGGATCGAAACAAAGAGGAATTCACAGACCTAAAACAAGGGAAGATGAATCCTAGGGAGATGCTCTGTTACTTTAAGAAGGGGTCTCGCAAGCGATTGCGTTCTTTGGCGACCTCTACTCCTTGCTCTACCTACCAAGAATTCTTTGAGGTTCTGCTTCAAATTGAAGATTTCGAGAATGCTCCCGATGATGATGATGAGGAAGAGGATAATAATAATAATAATGCTCAGATGAATAATAACAGAGTGCAAAAGGGGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Amidohydro_1

Protein Analysis

107

Amino Acids

12.73

Weight (kDa)

5.27

Isoelectric Point (pI)

47.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000370)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g29481 FvH4_2g11454 FvH4_3g19661 FvH4_3g28463 FvH4_3g31691 FvH4_3g34551 FvH4_3g35241 FvH4_4g06575 FvH4_4g09082 FvH4_4g15804 FvH4_4g15805 FvH4_4g16178 FvH4_4g16282 FvH4_5g25163 FvH4_6g27413 FvH4_7g02962 FvH4_7g04361
malus_domestica MD01G1095000.v1.1 MD02G1270200.v1.1 MD02G1270300.v1.1 MD02G1270400.v1.1 MD06G1059100.v1.1 MD08G1226500.v1.1
prunus_persica Prupe.1G169500_v2.0.a1 Prupe.5G195800_v2.0.a1
pyrus_communis pycom01g00010 pycom01g00770 pycom02g23140 pycom03g11760 pycom04g06090 pycom05g06900 pycom05g08070 pycom05g14500 pycom06g03050 pycom07g06250 pycom07g07540 pycom07g10580 pycom08g04990 pycom1146g00060 pycom11g01080 pycom11g15270 pycom11g15460 pycom11g24900 pycom12419g00150 pycom12424g00120 pycom13g08740 pycom13g24950 pycom13g25960 pycom13g26030 pycom13g27820 pycom16g23270 pycom16g25020 pycom16g25960 pycom17g07780 pycom17g08210 pycom17g13100
rosa_chinensis RchiOBHm_Chr1g0329421 RchiOBHm_Chr4g0397711 RchiOBHm_Chr4g0403481 RchiOBHm_Chr5g0019091 RchiOBHm_Chr5g0049101
rosa_laevigata RLG00000029892
rosa_multiflora Rmu_sc0001866.1_g000007
rosa_roxburghii Rroxscaffold_2G00094160 Rroxscaffold_3G00229110 Rroxscaffold_4G00321100 Rroxscaffold_7G00196040 Rroxscaffold_7G00196280
rosa_rugosa Rorug05G0160500 Rorug06G0096500
rosa_samantha Rh1AG098600 Rh1AG098800 Rh1BG078200 Rh1BG078700 Rh1BG178500 Rh1CG094600 Rh1CG094900 Rh1DG101700 Rh1DG109600 Rh2AG175800 Rh2AG175900 Rh2AG511400 Rh2BG114700 Rh2CG042200 Rh2CG116600 Rh2CG317500 Rh2DG327700 Rh2DG337800 Rh4CG142700 Rh4DG113100 Rh5BG335800 Rh5CG360600 Rh5DG352000 Rh6BG071400 Rh6BG417100 Rh6CG463300 Rh6CG463400 Rh7BG186600 Rh7CG196500 Rh7CG196600 Rh7CG448900 Rh7DG228300
rosa_wichuraiana Rw4G006560 Rw4G017340 Rw5G030450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 69
AcsI RAATTY 2 cut(s) 77, 197
AfaI GTAC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 31
AgsI TTSAA 3 cut(s) 19, 218, 224
Alw26I GTCTC 1 cut(s) 147
AlwI GGATC 1 cut(s) 69
ApoI RAATTY 2 cut(s) 77, 197
AspA2I CCTAGG 1 cut(s) 110
AvrII CCTAGG 1 cut(s) 110
BbsI GAAGAC 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 2 cut(s) 36, 111
BlnI CCTAGG 1 cut(s) 110
BmsI GCATC 1 cut(s) 108
BpiI GAAGAC 1 cut(s) 7
BsaI GGTCTC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 110
BsaXI ACNNNNNCTCC 2 cut(s) 160, 190
Bsc4I CCNNNNNNNGG 1 cut(s) 31
BseDI CCNNGG 1 cut(s) 110
BseGI GGATG 1 cut(s) 16
BseLI CCNNNNNNNGG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 299
BslI CCNNNNNNNGG 1 cut(s) 31
BsmAI GTCTC 1 cut(s) 147
BsmI GAATGC 1 cut(s) 241
Bso31I GGTCTC 1 cut(s) 147
Bsp143I GATC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 298
BspPI GGATC 1 cut(s) 69
BspTNI GGTCTC 1 cut(s) 147
BssECI CCNNGG 1 cut(s) 110
BssMI GATC 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 110
Bst6I CTCTTC 1 cut(s) 255
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 285
BstENI CCTNNNNNAGG 1 cut(s) 29
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 1 cut(s) 61
BstV2I GAAGAC 1 cut(s) 7
BtsCI GGATG 1 cut(s) 16
Cac8I GCNNGC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 55
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
CviQI GTAC 1 cut(s) 55
DdeI CTNAG 1 cut(s) 285
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eam1104I CTCTTC 1 cut(s) 255
EarI CTCTTC 1 cut(s) 255
Eco130I CCWWGG 1 cut(s) 110
Eco31I GGTCTC 1 cut(s) 147
EcoNI CCTNNNNNAGG 1 cut(s) 29
EcoRI GAATTC 2 cut(s) 77, 197
EcoT14I CCWWGG 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 110
FokI GGATG 1 cut(s) 23
FspBI CTAG 2 cut(s) 36, 111
HinfI GANTC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 2 cut(s) 51, 288
Hpy188III TCNNGA 2 cut(s) 232, 242
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 307
HpyF3I CTNAG 1 cut(s) 285
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 244
LweI GCATC 1 cut(s) 108
MaeI CTAG 2 cut(s) 36, 111
MaeIII GTNAC 1 cut(s) 125
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 4 cut(s) 7, 112, 236, 272
MluCI AATT 3 cut(s) 77, 197, 219
MnlI CCTC 7 cut(s) 25, 57, 67, 181, 199, 250, 256
MseI TTAA 1 cut(s) 132
Mva1269I GAATGC 1 cut(s) 241
NdeII GATC 1 cut(s) 61
PctI GAATGC 1 cut(s) 241
PfeI GAWTC 1 cut(s) 106
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
SaqAI TTAA 1 cut(s) 132
Sau3AI GATC 1 cut(s) 61
SetI ASST 6 cut(s) 41, 49, 90, 173, 191, 210
SfaNI GCATC 1 cut(s) 108
Sse9I AATT 3 cut(s) 77, 197, 219
SspMI CTAG 2 cut(s) 36, 111
StyI CCWWGG 1 cut(s) 110
TaqI TCGA 2 cut(s) 64, 231
TasI AATT 3 cut(s) 77, 197, 219
TatI WGTACW 1 cut(s) 54
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 2 cut(s) 119, 305
XagI CCTNNNNNAGG 1 cut(s) 29
XapI RAATTY 2 cut(s) 77, 197
XmaJI CCTAGG 1 cut(s) 110
XspI CTAG 2 cut(s) 36, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.