FvH4_5g13112

protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0001220
Physical Location & Seq
Forward (+)
7403153 .. 7404146
994 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g13112.t1

Sequence Viewer

Length: 381 bp
ATGACATTCTTTTGTCCATCTCCAGAATCAAAAAGATACAAAGCTGCTACTATCCGAATTGACAGCCCTGGGGGTGACGCTCTTGCTTCTGATTTAATGTGGGAGAGATCAAACTTTTGGCTGCATCAAAACCGGTCATGGCATCAATGTCGGATGTGGCAGCAATTGTCACAGGGAAGTTTAACCTGGGAAAACTGTATTGAGATGATTGGCTCCAACAAAGAAATCATATCAAGGGGAAAATTTGCCGAGGTTCTTGCAGCAGAACAGCGACCCTTCAGACCAGAGGAAGCTAAACTCTTTGCTAAGTCTGCACAGAATTCATATAAGCAATTTCACGACAAGGCAGCTTCTTTCAGATTAATGACTGTATGTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S49

Protein Analysis

127

Amino Acids

14.67

Weight (kDa)

9.02

Isoelectric Point (pI)

54.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 242, 319
AcuI CTGAAG 1 cut(s) 262
AgeI ACCGGT 1 cut(s) 132
AjnI CCWGG 2 cut(s) 67, 185
AluBI AGCT 3 cut(s) 44, 293, 350
AluI AGCT 3 cut(s) 44, 293, 350
ApeKI GCWGC 5 cut(s) 44, 121, 160, 260, 347
ApoI RAATTY 2 cut(s) 242, 319
AseI ATTAAT 1 cut(s) 362
AsiGI ACCGGT 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 86
BbvI GCAGC 5 cut(s) 31, 108, 172, 272, 359
BccI CCATC 1 cut(s) 25
BcgI CGANNNNNNTGC 4 cut(s) 131, 165, 239, 273
BciT130I CCWGG 2 cut(s) 69, 187
BisI GCNGC 5 cut(s) 45, 122, 161, 261, 348
BlsI GCNGC 5 cut(s) 46, 123, 162, 262, 349
Bme1390I CCNGG 2 cut(s) 69, 187
BmiI GGNNCC 1 cut(s) 214
BmrFI CCNGG 2 cut(s) 69, 187
BmsI GCATC 2 cut(s) 133, 151
BpmI CTGGAG 1 cut(s) 6
BsaJI CCNNGG 4 cut(s) 67, 68, 186, 249
BsaWI WCCGGW 1 cut(s) 132
Bse118I RCCGGY 1 cut(s) 132
BseBI CCWGG 2 cut(s) 69, 187
BseDI CCNNGG 4 cut(s) 67, 68, 186, 249
BseGI GGATG 1 cut(s) 159
BseXI GCAGC 5 cut(s) 31, 108, 172, 272, 359
BsgI GTGCAG 1 cut(s) 297
BshTI ACCGGT 1 cut(s) 132
BsiSI CCGG 1 cut(s) 133
Bsp143I GATC 1 cut(s) 107
BspLI GGNNCC 1 cut(s) 214
BsrFI RCCGGY 1 cut(s) 132
BssAI RCCGGY 1 cut(s) 132
BssECI CCNNGG 4 cut(s) 67, 68, 186, 249
BssMI GATC 1 cut(s) 107
Bst2UI CCWGG 2 cut(s) 69, 187
Bst4CI ACNGT 2 cut(s) 197, 370
BstDEI CTNAG 1 cut(s) 306
BstF5I GGATG 1 cut(s) 159
BstKTI GATC 1 cut(s) 110
BstMBI GATC 1 cut(s) 107
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstNI CCWGG 2 cut(s) 69, 187
BstSCI CCNGG 2 cut(s) 67, 185
BstV1I GCAGC 5 cut(s) 31, 108, 172, 272, 359
BtsCI GGATG 1 cut(s) 159
Cfr10I RCCGGY 1 cut(s) 132
CseI GACGC 1 cut(s) 86
CspAI ACCGGT 1 cut(s) 132
CviAII CATG 1 cut(s) 138
CviJI RGCY 6 cut(s) 44, 66, 121, 213, 293, 350
CviKI_1 RGCY 6 cut(s) 44, 66, 121, 213, 293, 350
DdeI CTNAG 1 cut(s) 306
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 262
EcoRI GAATTC 1 cut(s) 319
EcoRII CCWGG 2 cut(s) 67, 185
FaeI CATG 1 cut(s) 141
FaiI YATR 5 cut(s) 139, 230, 325, 327, 373
FatI CATG 1 cut(s) 137
Fnu4HI GCNGC 5 cut(s) 45, 122, 161, 261, 348
FokI GGATG 1 cut(s) 166
Fsp4HI GCNGC 5 cut(s) 45, 122, 161, 261, 348
GluI GCNGC 5 cut(s) 45, 122, 161, 261, 348
GsuI CTGGAG 1 cut(s) 6
HapII CCGG 1 cut(s) 133
HgaI GACGC 1 cut(s) 86
Hin1II CATG 1 cut(s) 141
HinfI GANTC 1 cut(s) 26
HpaII CCGG 1 cut(s) 133
HphI GGTGA 1 cut(s) 86
Hpy188I TCNGA 6 cut(s) 56, 91, 153, 281, 359, 380
Hpy188III TCNNGA 2 cut(s) 23, 338
HpyAV CCTTC 1 cut(s) 286
HpyCH4III ACNGT 2 cut(s) 197, 370
HpyCH4V TGCA 3 cut(s) 124, 260, 314
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 1 cut(s) 306
Hsp92II CATG 1 cut(s) 141
Kzo9I GATC 1 cut(s) 107
LmnI GCTCC 1 cut(s) 218
LpnPI CCDG 8 cut(s) 36, 54, 81, 146, 158, 172, 199, 297
Lsp1109I GCAGC 5 cut(s) 31, 108, 172, 272, 359
LweI GCATC 2 cut(s) 133, 151
MaeIII GTNAC 2 cut(s) 74, 168
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MfeI CAATTG 1 cut(s) 164
MluCI AATT 5 cut(s) 57, 164, 242, 319, 332
MmeI TCCRAC 2 cut(s) 131, 240
MnlI CCTC 2 cut(s) 244, 280
MseI TTAA 3 cut(s) 95, 182, 362
MspI CCGG 1 cut(s) 133
MspR9I CCNGG 2 cut(s) 69, 187
MunI CAATTG 1 cut(s) 164
MvaI CCWGG 2 cut(s) 69, 187
MwoI GCNNNNNNNGC 1 cut(s) 311
NdeII GATC 1 cut(s) 107
NlaIII CATG 1 cut(s) 141
NlaIV GGNNCC 1 cut(s) 214
NmeAIII GCCGAG 1 cut(s) 274
NmuCI GTSAC 2 cut(s) 74, 168
PasI CCCWGGG 1 cut(s) 68
PfeI GAWTC 1 cut(s) 26
PinAI ACCGGT 1 cut(s) 132
PkrI GCNGC 5 cut(s) 46, 123, 162, 262, 349
PshBI ATTAAT 1 cut(s) 362
Psp6I CCWGG 2 cut(s) 67, 185
PspGI CCWGG 2 cut(s) 67, 185
PspN4I GGNNCC 1 cut(s) 214
SaqAI TTAA 3 cut(s) 95, 182, 362
SatI GCNGC 5 cut(s) 45, 122, 161, 261, 348
Sau3AI GATC 1 cut(s) 107
ScrFI CCNGG 2 cut(s) 69, 187
SetI ASST 5 cut(s) 46, 188, 255, 295, 352
SfaNI GCATC 2 cut(s) 133, 151
Sse9I AATT 5 cut(s) 57, 164, 242, 319, 332
StyD4I CCNGG 2 cut(s) 67, 185
TaaI ACNGT 2 cut(s) 197, 370
TasI AATT 5 cut(s) 57, 164, 242, 319, 332
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 3 cut(s) 95, 182, 362
Tru9I TTAA 3 cut(s) 95, 182, 362
TseFI GTSAC 2 cut(s) 74, 168
TseI GCWGC 5 cut(s) 44, 121, 160, 260, 347
Tsp45I GTSAC 2 cut(s) 74, 168
TspDTI ATGAA 1 cut(s) 312
VspI ATTAAT 1 cut(s) 362
XapI RAATTY 2 cut(s) 242, 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.