Rh4CG063900

protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0001220
Physical Location & Seq
Forward (+)
11972926 .. 11973400
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG063900.1

Sequence Viewer

Length: 207 bp
ATGTCTGACGTGGCAACAAGTGAAGGATACTATATGGCAATGGCAGCAGATGCCATTGTTGCAGAAAATTTAACCTTAACTAGTTCCATTGGAGTTGTCACAGGTAAGTTTAACCTGGGAAAACTGTATAAGAAGATTGGCTTCGACAAGGAAATCATATCAAGGGGGAATTTGCAGAGGTTCTTGCAACTGAACAACGACCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S49

Protein Analysis

68

Amino Acids

7.45

Weight (kDa)

6.08

Isoelectric Point (pI)

35.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S49 PF01343 1 - 65 2.8e-15 Peptidase family S49
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 67, 169
AhlI ACTAGT 1 cut(s) 80
AjiI CACGTC 1 cut(s) 10
AjnI CCWGG 1 cut(s) 114
ApeKI GCWGC 1 cut(s) 44
ApoI RAATTY 2 cut(s) 67, 169
BbvI GCAGC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 116
BciVI GTATCC 1 cut(s) 20
BcuI ACTAGT 1 cut(s) 80
BfaI CTAG 1 cut(s) 81
BfuI GTATCC 1 cut(s) 20
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 116
BmgBI CACGTC 1 cut(s) 10
BmrFI CCNGG 1 cut(s) 116
BmsI GCATC 1 cut(s) 40
BsaJI CCNNGG 1 cut(s) 115
Bse3DI GCAATG 1 cut(s) 45
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 115
BseMI GCAATG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 45
BssECI CCNNGG 1 cut(s) 115
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 126
BstAPI GCANNNNNTGC 1 cut(s) 50
BstMWI GCNNNNNNNGC 3 cut(s) 44, 50, 59
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstV1I GCAGC 1 cut(s) 56
BsuI GTATCC 1 cut(s) 20
BtrI CACGTC 1 cut(s) 10
CviJI RGCY 1 cut(s) 141
CviKI_1 RGCY 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 114
FaiI YATR 4 cut(s) 33, 35, 129, 158
FalI AAGNNNNNCTT 2 cut(s) 125, 157
Fnu4HI GCNGC 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 45
FspBI CTAG 1 cut(s) 81
GluI GCNGC 1 cut(s) 45
Hpy188I TCNGA 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 62, 175, 187
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 50, 59
HpySE526I ACGT 1 cut(s) 9
LpnPI CCDG 3 cut(s) 87, 101, 128
Lsp1109I GCAGC 1 cut(s) 56
LweI GCATC 1 cut(s) 40
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 97
MboII GAAGA 1 cut(s) 145
MluCI AATT 2 cut(s) 67, 169
MnlI CCTC 1 cut(s) 171
MseI TTAA 4 cut(s) 71, 77, 111, 205
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
MwoI GCNNNNNNNGC 3 cut(s) 44, 50, 59
NmuCI GTSAC 1 cut(s) 97
PkrI GCNGC 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
SaqAI TTAA 4 cut(s) 71, 77, 111, 205
SatI GCNGC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 116
SetI ASST 6 cut(s) 12, 77, 106, 117, 182, 204
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 9 cut(s) 22, 30, 93, 114, 127, 128, 160, 174, 196
SpeI ACTAGT 1 cut(s) 80
Sse9I AATT 2 cut(s) 67, 169
SspMI CTAG 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 126
TaiI ACGT 1 cut(s) 12
TaqI TCGA 1 cut(s) 144
TasI AATT 2 cut(s) 67, 169
Tru1I TTAA 4 cut(s) 71, 77, 111, 205
Tru9I TTAA 4 cut(s) 71, 77, 111, 205
TseFI GTSAC 1 cut(s) 97
TseI GCWGC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 97
XapI RAATTY 2 cut(s) 67, 169
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.