Rw7G042150

protease

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
65834753 .. 65835547
795 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G042150.1

Sequence Viewer

Length: 336 bp
ATGTCTGATGTGGCAGCAAGTGGAGGATACTATATGGCTATGGCAGCAGATGCCATTGTTGCAGAAAATCTAACCTTAACTGGTTCCATTGGAGTTGTCACAGGGAAGTTTAACCTTGGAAAACTGTATGAGAAGATAGGCTTCAACAAAGAAATCATATCACGGGGAAAATTTGCAGAGGTTCTTGCAGCTGAACAACGACCCTTCAGACCAGAGGAAGCTGAACTTTTTGCCAAGTCTGCACAGGATTCGTATAAGCAATTACGGGGCAAGGCAGCTTCTTCCAGATCAATGACTGTAGATAAAATGGAGGAAGTTGCACAAGGGAGAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.0

Weight (kDa)

7.93

Isoelectric Point (pI)

46.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S49 PF01343 1 - 111 3.7e-27 Peptidase family S49
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 190
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 3 cut(s) 191, 221, 278
AluI AGCT 3 cut(s) 191, 221, 278
ApeKI GCWGC 4 cut(s) 14, 44, 188, 275
ApoI RAATTY 1 cut(s) 170
BbvI GCAGC 4 cut(s) 26, 56, 200, 287
BcgI CGANNNNNNTGC 2 cut(s) 231, 265
BciVI GTATCC 1 cut(s) 20
BfmI CTRYAG 1 cut(s) 297
BfuI GTATCC 1 cut(s) 20
BisI GCNGC 4 cut(s) 15, 45, 189, 276
BlsI GCNGC 4 cut(s) 16, 46, 190, 277
BmiI GGNNCC 1 cut(s) 85
BmsI GCATC 1 cut(s) 40
BsaJI CCNNGG 1 cut(s) 115
Bse1I ACTGG 1 cut(s) 85
BseDI CCNNGG 1 cut(s) 115
BseNI ACTGG 1 cut(s) 85
BseXI GCAGC 4 cut(s) 26, 56, 200, 287
BsgI GTGCAG 1 cut(s) 225
Bsp143I GATC 1 cut(s) 287
BspLI GGNNCC 1 cut(s) 85
BsrI ACTGG 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 115
BssMI GATC 1 cut(s) 287
BssT1I CCWWGG 1 cut(s) 115
Bst4CI ACNGT 2 cut(s) 126, 298
BstAPI GCANNNNNTGC 1 cut(s) 50
BstKTI GATC 1 cut(s) 290
BstMBI GATC 1 cut(s) 287
BstMWI GCNNNNNNNGC 4 cut(s) 44, 50, 59, 239
BstSFI CTRYAG 1 cut(s) 297
BstV1I GCAGC 4 cut(s) 26, 56, 200, 287
BsuI GTATCC 1 cut(s) 20
CviJI RGCY 5 cut(s) 38, 141, 191, 221, 278
CviKI_1 RGCY 5 cut(s) 38, 141, 191, 221, 278
DpnI GATC 1 cut(s) 289
DpnII GATC 1 cut(s) 287
Eco130I CCWWGG 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 190
EcoT14I CCWWGG 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 115
FaiI YATR 6 cut(s) 33, 35, 41, 129, 158, 255
FalI AAGNNNNNCTT 4 cut(s) 125, 157, 210, 242
Fnu4HI GCNGC 4 cut(s) 15, 45, 189, 276
Fsp4HI GCNGC 4 cut(s) 15, 45, 189, 276
GluI GCNGC 4 cut(s) 15, 45, 189, 276
HinfI GANTC 1 cut(s) 248
Hpy188I TCNGA 2 cut(s) 7, 209
Hpy188III TCNNGA 1 cut(s) 285
HpyAV CCTTC 1 cut(s) 214
HpyCH4III ACNGT 2 cut(s) 126, 298
HpyCH4V TGCA 5 cut(s) 62, 176, 188, 242, 320
HpyF10VI GCNNNNNNNGC 4 cut(s) 44, 50, 59, 239
Kzo9I GATC 1 cut(s) 287
LpnPI CCDG 5 cut(s) 66, 87, 225, 230, 298
Lsp1109I GCAGC 4 cut(s) 26, 56, 200, 287
LweI GCATC 1 cut(s) 40
MaeIII GTNAC 1 cut(s) 97
MalI GATC 1 cut(s) 289
MboI GATC 1 cut(s) 287
MboII GAAGA 2 cut(s) 145, 273
MluCI AATT 2 cut(s) 170, 260
MnlI CCTC 4 cut(s) 17, 172, 208, 304
MseI TTAA 2 cut(s) 77, 111
MspA1I CMGCKG 1 cut(s) 191
MwoI GCNNNNNNNGC 4 cut(s) 44, 50, 59, 239
NdeII GATC 1 cut(s) 287
NlaIV GGNNCC 1 cut(s) 85
NmuCI GTSAC 1 cut(s) 97
PfeI GAWTC 1 cut(s) 248
PkrI GCNGC 4 cut(s) 16, 46, 190, 277
PspN4I GGNNCC 1 cut(s) 85
PvuII CAGCTG 1 cut(s) 191
SaqAI TTAA 2 cut(s) 77, 111
SatI GCNGC 4 cut(s) 15, 45, 189, 276
Sau3AI GATC 1 cut(s) 287
SetI ASST 6 cut(s) 77, 117, 183, 193, 223, 280
SfaNI GCATC 1 cut(s) 40
SfcI CTRYAG 1 cut(s) 297
Sse9I AATT 2 cut(s) 170, 260
StyI CCWWGG 1 cut(s) 115
TaaI ACNGT 2 cut(s) 126, 298
TasI AATT 2 cut(s) 170, 260
TfiI GAWTC 1 cut(s) 248
Tru1I TTAA 2 cut(s) 77, 111
Tru9I TTAA 2 cut(s) 77, 111
TseFI GTSAC 1 cut(s) 97
TseI GCWGC 4 cut(s) 14, 44, 188, 275
Tsp45I GTSAC 1 cut(s) 97
XapI RAATTY 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.