Rroxscaffold_5G00361620

protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0001220
Physical Location & Seq
Forward (+)
42314954 .. 42317251
2298 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00361620.1

Sequence Viewer

Length: 738 bp
ATGTCAAAATTGGGGCCGGAAGTCTATTTTTGGAACATTGAAGTATGGCCAAGAAATTATGGCAGTGAAGGGGAGGGTCTTGCAAGTTCCACCGGTGTTCAGGCATCGTTTGTAAGAGGTGTTCTTGAGAAAACTGAAGTTGAGCCACAAGTGGAAAGGATTAGTAAATACGAAAGTGCTGTAATATTGATTCTCTTGCTTGACCCTGGTGGTGATGCCCTTGCTTCTGATTTGATGTGGAGGGAAATCAAACTTTTGGCTGCATCAAAACCGGTCATCGCATCAATGTCTGACGTGGCAGCAAGTGGAAGATACTATATGGCAATGGCAGCAGATGCCATTTTTAACCTGGGAAAAATGTATGAGAAGATTGGCTTCGACAAGGAAATCATATCAAGGGGCAATTTGCGGAGACTAGAGGAAGCTGAACTCTTTGCTAAGTCTACACAGAATTCGTATAAGCAATTTCGGGACAAGGTAGCTTCTTCCAGATCAATGACTGTAGATAAAATGGAGGAAGTTGCACAAGGGAGAGTTTGGGCAGGTAAAGATGCAGCTTTAAGGGGTTTAGTTAATGCTATTGGTGGACTTTCTCAGGTTGTTGCAATAGCAAAGCTCAAGGCAAATATACCACAAGACACAGAGGAATCCCAGTCAACGCAGGAATCTGATGAGGCTAGGAAACCTGAAGGCATTAGGAGACCACATGAAGACGTGGGAGATATTTTGGGAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S49

Protein Analysis

245

Amino Acids

26.93

Weight (kDa)

5.14

Isoelectric Point (pI)

50.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S49 PF01343 86 - 209 7.1e-18 Peptidase family S49
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 533
AccI GTMKAC 1 cut(s) 443
AciI CCGC 1 cut(s) 409
AcoI YGGCCR 1 cut(s) 47
AcsI RAATTY 1 cut(s) 451
AcuI CTGAAG 2 cut(s) 156, 708
AgeI ACCGGT 2 cut(s) 92, 271
AgsI TTSAA 1 cut(s) 41
AjiI CACGTC 2 cut(s) 295, 715
AjnI CCWGG 2 cut(s) 205, 348
AluBI AGCT 4 cut(s) 425, 482, 557, 616
AluI AGCT 4 cut(s) 425, 482, 557, 616
Alw26I GTCTC 2 cut(s) 406, 694
AoxI GGCC 2 cut(s) 14, 47
ApeKI GCWGC 4 cut(s) 260, 299, 329, 554
ApoI RAATTY 1 cut(s) 451
AsiGI ACCGGT 2 cut(s) 92, 271
AspS9I GGNCC 1 cut(s) 14
AsuHPI GGTGA 1 cut(s) 224
BalI TGGCCA 1 cut(s) 49
BbsI GAAGAC 1 cut(s) 717
BbvI GCAGC 4 cut(s) 247, 311, 341, 566
BciT130I CCWGG 2 cut(s) 207, 350
BcoDI GTCTC 2 cut(s) 406, 694
BfaI CTAG 2 cut(s) 416, 678
BfmI CTRYAG 1 cut(s) 501
BfuAI ACCTGC 1 cut(s) 533
BisI GCNGC 4 cut(s) 261, 300, 330, 555
BlsI GCNGC 4 cut(s) 262, 301, 331, 556
Bme1390I CCNGG 2 cut(s) 207, 350
BmgBI CACGTC 2 cut(s) 295, 715
BmgT120I GGNCC 1 cut(s) 14
BmiI GGNNCC 1 cut(s) 15
BmrFI CCNGG 2 cut(s) 207, 350
BmrI ACTGGG 1 cut(s) 646
BmsI GCATC 6 cut(s) 113, 205, 272, 290, 325, 541
BmuI ACTGGG 1 cut(s) 646
BpiI GAAGAC 1 cut(s) 717
BpuEI CTTGAG 2 cut(s) 146, 602
BsaI GGTCTC 1 cut(s) 694
BsaJI CCNNGG 2 cut(s) 205, 349
BsaWI WCCGGW 2 cut(s) 92, 271
Bse118I RCCGGY 2 cut(s) 92, 271
Bse1I ACTGG 1 cut(s) 652
Bse3DI GCAATG 1 cut(s) 330
BseBI CCWGG 2 cut(s) 207, 350
BseDI CCNNGG 2 cut(s) 205, 349
BseMI GCAATG 1 cut(s) 330
BseMII CTCAG 1 cut(s) 608
BseNI ACTGG 1 cut(s) 652
BseXI GCAGC 4 cut(s) 247, 311, 341, 566
BshFI GGCC 2 cut(s) 16, 49
BshTI ACCGGT 2 cut(s) 92, 271
BsiSI CCGG 3 cut(s) 17, 93, 272
BslFI GGGAC 1 cut(s) 485
BsmAI GTCTC 2 cut(s) 406, 694
BsmFI GGGAC 1 cut(s) 485
BsnI GGCC 2 cut(s) 16, 49
Bso31I GGTCTC 1 cut(s) 694
Bsp143I GATC 1 cut(s) 491
BspACI CCGC 1 cut(s) 409
BspANI GGCC 2 cut(s) 16, 49
BspCNI CTCAG 1 cut(s) 607
BspLI GGNNCC 1 cut(s) 15
BspMI ACCTGC 1 cut(s) 533
BspTNI GGTCTC 1 cut(s) 694
BsrDI GCAATG 1 cut(s) 330
BsrFI RCCGGY 2 cut(s) 92, 271
BsrI ACTGG 1 cut(s) 652
BssAI RCCGGY 2 cut(s) 92, 271
BssECI CCNNGG 2 cut(s) 205, 349
BssMI GATC 1 cut(s) 491
Bst2UI CCWGG 2 cut(s) 207, 350
Bst4CI ACNGT 1 cut(s) 502
BstAPI GCANNNNNTGC 1 cut(s) 335
BstDEI CTNAG 2 cut(s) 438, 594
BstKTI GATC 1 cut(s) 494
BstMAI GTCTC 2 cut(s) 406, 694
BstMBI GATC 1 cut(s) 491
BstMWI GCNNNNNNNGC 2 cut(s) 329, 335
BstNI CCWGG 2 cut(s) 207, 350
BstSCI CCNGG 2 cut(s) 205, 348
BstSFI CTRYAG 1 cut(s) 501
BstV1I GCAGC 4 cut(s) 247, 311, 341, 566
BstV2I GAAGAC 1 cut(s) 717
BsuRI GGCC 2 cut(s) 16, 49
BtgZI GCGATG 1 cut(s) 262
BtrI CACGTC 2 cut(s) 295, 715
BtsI GCAGTG 1 cut(s) 70
BtsIMutI CAGTG 1 cut(s) 70
BveI ACCTGC 1 cut(s) 533
Cfr10I RCCGGY 2 cut(s) 92, 271
Cfr13I GGNCC 1 cut(s) 14
CspAI ACCGGT 2 cut(s) 92, 271
CviAII CATG 1 cut(s) 707
DdeI CTNAG 2 cut(s) 438, 594
DpnI GATC 1 cut(s) 493
DpnII GATC 1 cut(s) 491
EaeI YGGCCR 1 cut(s) 47
Eco31I GGTCTC 1 cut(s) 694
Eco57I CTGAAG 2 cut(s) 156, 708
EcoRI GAATTC 1 cut(s) 451
EcoRII CCWGG 2 cut(s) 205, 348
FaeI CATG 1 cut(s) 710
FaiI YATR 9 cut(s) 46, 60, 318, 320, 363, 392, 459, 629, 708
FalI AAGNNNNNCTT 2 cut(s) 359, 391
FaqI GGGAC 1 cut(s) 485
FatI CATG 1 cut(s) 706
FblI GTMKAC 1 cut(s) 443
Fnu4HI GCNGC 4 cut(s) 261, 300, 330, 555
Fsp4HI GCNGC 4 cut(s) 261, 300, 330, 555
FspBI CTAG 2 cut(s) 416, 678
GluI GCNGC 4 cut(s) 261, 300, 330, 555
HaeIII GGCC 2 cut(s) 16, 49
HapII CCGG 3 cut(s) 17, 93, 272
Hin1II CATG 1 cut(s) 710
HincII GTYRAC 1 cut(s) 657
HindII GTYRAC 1 cut(s) 657
HinfI GANTC 3 cut(s) 190, 647, 665
HpaII CCGG 3 cut(s) 17, 93, 272
HphI GGTGA 1 cut(s) 224
Hpy166II GTNNAC 3 cut(s) 444, 587, 657
Hpy188I TCNGA 3 cut(s) 229, 292, 670
Hpy188III TCNNGA 3 cut(s) 125, 470, 489
Hpy8I GTNNAC 3 cut(s) 444, 587, 657
HpyAV CCTTC 2 cut(s) 62, 683
HpyCH4III ACNGT 1 cut(s) 502
HpyCH4IV ACGT 2 cut(s) 294, 714
HpyCH4V TGCA 5 cut(s) 83, 263, 524, 554, 605
HpyF10VI GCNNNNNNNGC 2 cut(s) 329, 335
HpyF3I CTNAG 2 cut(s) 438, 594
HpySE526I ACGT 2 cut(s) 294, 714
Hsp92II CATG 1 cut(s) 710
Kzo9I GATC 1 cut(s) 491
Lsp1109I GCAGC 4 cut(s) 247, 311, 341, 566
LweI GCATC 6 cut(s) 113, 205, 272, 290, 325, 541
MaeI CTAG 2 cut(s) 416, 678
MaeII ACGT 2 cut(s) 294, 714
MalI GATC 1 cut(s) 493
MboI GATC 1 cut(s) 491
MboII GAAGA 4 cut(s) 321, 379, 477, 722
MlsI TGGCCA 1 cut(s) 49
MluCI AATT 5 cut(s) 8, 55, 403, 451, 464
MluNI TGGCCA 1 cut(s) 49
MnlI CCTC 7 cut(s) 67, 110, 234, 412, 508, 637, 667
Mox20I TGGCCA 1 cut(s) 49
MscI TGGCCA 1 cut(s) 49
MseI TTAA 4 cut(s) 345, 560, 573, 736
Msp20I TGGCCA 1 cut(s) 49
MspI CCGG 3 cut(s) 17, 93, 272
MspR9I CCNGG 2 cut(s) 207, 350
MvaI CCWGG 2 cut(s) 207, 350
MwoI GCNNNNNNNGC 2 cut(s) 329, 335
NdeII GATC 1 cut(s) 491
NlaIII CATG 1 cut(s) 710
NlaIV GGNNCC 1 cut(s) 15
PfeI GAWTC 3 cut(s) 190, 647, 665
PinAI ACCGGT 2 cut(s) 92, 271
PkrI GCNGC 4 cut(s) 262, 301, 331, 556
Psp6I CCWGG 2 cut(s) 205, 348
PspGI CCWGG 2 cut(s) 205, 348
PspN4I GGNNCC 1 cut(s) 15
PspPI GGNCC 1 cut(s) 14
PsrI GAACNNNNNNTAC 2 cut(s) 105, 137
SaqAI TTAA 4 cut(s) 345, 560, 573, 736
SatI GCNGC 4 cut(s) 261, 300, 330, 555
Sau3AI GATC 1 cut(s) 491
Sau96I GGNCC 1 cut(s) 14
ScrFI CCNGG 2 cut(s) 207, 350
SfaNI GCATC 6 cut(s) 113, 205, 272, 290, 325, 541
SfcI CTRYAG 1 cut(s) 501
SgrAI CRCCGGYG 1 cut(s) 92
SmlI CTYRAG 2 cut(s) 125, 617
SmoI CTYRAG 2 cut(s) 125, 617
Sse9I AATT 5 cut(s) 8, 55, 403, 451, 464
SsiI CCGC 1 cut(s) 409
SspI AATATT 1 cut(s) 186
SspMI CTAG 2 cut(s) 416, 678
StyD4I CCNGG 2 cut(s) 205, 348
TaaI ACNGT 1 cut(s) 502
TaiI ACGT 2 cut(s) 297, 717
TaqI TCGA 1 cut(s) 378
TasI AATT 5 cut(s) 8, 55, 403, 451, 464
TfiI GAWTC 3 cut(s) 190, 647, 665
Tru1I TTAA 4 cut(s) 345, 560, 573, 736
Tru9I TTAA 4 cut(s) 345, 560, 573, 736
TscAI CASTG 1 cut(s) 70
TseI GCWGC 4 cut(s) 260, 299, 329, 554
TspDTI ATGAA 1 cut(s) 723
TspRI CASTG 1 cut(s) 70
XapI RAATTY 1 cut(s) 451
XcmI CCANNNNNNNNNTGG 1 cut(s) 346
XmiI GTMKAC 1 cut(s) 443
XspI CTAG 2 cut(s) 416, 678
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.