RchiOBHm_Chr6g0264351

protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001220
Physical Location & Seq
Reverse (-)
19502318 .. 19503878
1561 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23709

Sequence Viewer

Length: 177 bp
ATGCTGACAGCATTGCTCGATAACATATATGGGAACTGGCTGGACATAATTTCTTCTACAAGAGAAAAAAAGAGAGAAGATATTGAGAAGTCTGTTAATGAAGGGGTGTACCATGTAGAGAAGCTGAAAGAAAGGGCTAGATCACAAACATACAGTATGATGATGAGGAAGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S49

Protein Analysis

58

Amino Acids

6.94

Weight (kDa)

9.1

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 110
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
BfaI CTAG 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 41
Bse3DI GCAATG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 41
Bsp143I GATC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 11
BsrI ACTGG 1 cut(s) 41
BssMI GATC 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 155
BstKTI GATC 1 cut(s) 143
BstMBI GATC 1 cut(s) 140
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 113
CviJI RGCY 3 cut(s) 40, 124, 137
CviKI_1 RGCY 3 cut(s) 40, 124, 137
CviQI GTAC 1 cut(s) 109
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
FaeI CATG 1 cut(s) 116
FaiI YATR 7 cut(s) 26, 28, 30, 47, 114, 151, 158
FatI CATG 1 cut(s) 112
FspBI CTAG 1 cut(s) 138
Hin1II CATG 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 95
HpyCH4III ACNGT 1 cut(s) 155
Hsp92II CATG 1 cut(s) 116
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 2 cut(s) 22, 26
MaeI CTAG 1 cut(s) 138
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 2 cut(s) 45, 89
MluCI AATT 1 cut(s) 48
MnlI CCTC 1 cut(s) 159
MseI TTAA 1 cut(s) 96
NdeII GATC 1 cut(s) 140
NlaIII CATG 1 cut(s) 116
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 1 cut(s) 140
SetI ASST 1 cut(s) 126
SgeI CNNG 6 cut(s) 29, 49, 53, 72, 125, 150
Sse9I AATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 138
TaaI ACNGT 1 cut(s) 155
TaqI TCGA 1 cut(s) 18
TasI AATT 1 cut(s) 48
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TspDTI ATGAA 1 cut(s) 114
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.