Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004712.1

Orthogroup ID

OG0001220

Physical Location & Seq

Genomic Coordinates Forward (+)

88683 .. 92064

Gene Structure 3382 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004712.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1662 bp

atgactgatcagttaaagagtcagttctctagtggattatcgctgcctcaaatttgtgagaattttgtgaaagttgcatatgatcctcaaattgctggtgtgtatcttcaaattgagagcttgaactgtggttggggtaagtttgttgtggcagacgcacctgcttgtagcgaaaaagaatattaccttgcttctgcttgtcaggagatttatgcccctccaagtgcttatttttctttgcttggtctcagtgttcaggcatcatttgtgagaggtgttcttgagaaaattggagttgagccacaagtggagaggattggtaaatacaaaagtgctggttaccaacttgagcacacgaccatgtccgaagaaaattgtgaaatgctgacagcattgcttgataacatatacgggaacaggctggacataatttcttctacaaaaggaaaaaagagagaagatattgagaagtttgttaatgaaggggtgtaccaagtagaaaagctgaaagaagagggctggatcacaaacattcagtatgatgatgaggttacttcaatgttgaaggaaagacttggagtacaaaaagagaaaaagcttcctatggttgattacaggaaatattctaaggtccggaaatggactcttggtttatcaggcggtaaagacaagatagccataataagagcctcaggcagtattagtcgtgtacgaggttcttttagtctacccggatcatctattgttggagaacagttcattgagaagttccgtagtataagaggtattgtgaatcaaaaagatacaaaggctgctattatccgaattgacagccctggaggtgatgcccttgcttctgatttgatgtggagggaaatcaaacttttggctgcatcaaaaccggtcattggatcaatgtctgacgtggcagcaagtggaggatactatatggctatggcagcagatgccattgttgcagaaagtctaaccttaactggttccattggagttgtcacagggaagtttaaccttggaaaactgtatgagaagattgcattcaacaaagaaattatatcacggggaaaatttgcggaggttcttgcagctgaacaacgacccttcaggtgcactgtcttgttgcatactctattttgtctgatttcttttataatcctgaaaggagacaaaattattagttctctttttcttcctaattcagaccagaggaagtttgctaagtctgcacagaattcgtataagcaatttcgggacaaggcagcttcttccagatcaatgactgtagataaaatggaggaagttgcacaagggagagtttgggctggtaaagatgcagcttcaaggggtttagttgatgctattggtggactttctcgggctgttgcaatagcaaagctcaaggcaaatataccacaagacacagaggttacactggtggaacttgtaagaccctccccttcactgccagaacttttaagtagcgtagggagtactctggttggagttgagcaaacgatgaagacactgctgcaagacttaacattttctgatggggttcaagcccggatggacggaatcttgtttcagagactggagggttcttctaatgccaaccccatcttcaatttgatgagagattactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_S49

Protein Analysis

553

Amino Acids

60.78

Weight (kDa)

8.77

Isoelectric Point (pI)

35.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001220)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G73990 AT1G73990
fragaria_vesca	FvH4_5g13110 FvH4_5g13112
malus_domestica	MD06G1207100.v1.1 MD14G1217600.v1.1
prunus_persica	Prupe.5G211500_v2.0.a1 Prupe.5G211500_v2.0.a1
pyrus_communis	pycom06g18500 pycom14g18030
rosa_chinensis	RchiOBHm_Chr2g0126491 RchiOBHm_Chr2g0152701 RchiOBHm_Chr6g0264331 RchiOBHm_Chr6g0264341 RchiOBHm_Chr6g0264351 RchiOBHm_Chr7g0184031 RchiOBHm_Chr7g0184041
rosa_laevigata	RLG00000005008
rosa_multiflora	Rmu_sc0000532.1_g000028 Rmu_sc0004712.1_g000014 Rmu_sc0004712.1_g000024 Rmu_sc0007533.1_g000011 Rmu_sc0010483.1_g000003
rosa_roxburghii	Rroxscaffold_176G00431720 Rroxscaffold_3G00219040 Rroxscaffold_3G00219050 Rroxscaffold_3G00269980 Rroxscaffold_5G00361620
rosa_rugosa	Rorug01G0193000 Rorug03G0324200 Rorug06G0461700
rosa_samantha	Rh2AG316100 Rh2AG421900 Rh2BG328900 Rh2CG409100 Rh4CG063900 Rh5CG558100 Rh6BG128500 Rh6CG126800 Rh6DG114100 Rh7AG063000 Rh7AG499000 Rh7AG499100 Rh7BG063200 Rh7BG469900 Rh7BG470100 Rh7CG064200 Rh7DG063300 Rh7DG063600 Rh7DG392100
rosa_wichuraiana	Rw0G022820 Rw6G011500 Rw7G005210 Rw7G005220 Rw7G020530 Rw7G042150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1169
AarI	CACCTGC	1 cut(s)	169
Acc36I	ACCTGC	1 cut(s)	169
AccI	GTMKAC	1 cut(s)	727
AccIII	TCCGGA	1 cut(s)	633
AciI	CCGC	2 cut(s)	660, 1091
AclWI	GGATC	4 cut(s)	77, 530, 742, 919
AcsI	RAATTY	4 cut(s)	51, 61, 1085, 1249
AcuI	CTGAAG	1 cut(s)	1105
AfaI	GTAC	4 cut(s)	491, 582, 711, 1510
AfiI	CCNNNNNNNGG	1 cut(s)	908
AgeI	ACCGGT	1 cut(s)	901
AgsI	TTSAA	8 cut(s)	110, 124, 558, 565, 1060, 1359, 1577, 1642
AjiI	CACGTC	1 cut(s)	925
AjnI	CCWGG	1 cut(s)	835
AjuI	GAANNNNNNNTTGG	2 cut(s)	1622, 1654
AluBI	AGCT	7 cut(s)	120, 505, 598, 1106, 1280, 1355, 1414
AluI	AGCT	7 cut(s)	120, 505, 598, 1106, 1280, 1355, 1414
Alw21I	GWGCWC	2 cut(s)	354, 1130
Alw26I	GTCTC	3 cut(s)	251, 1176, 1600
Alw44I	GTGCAC	1 cut(s)	1126
AlwI	GGATC	4 cut(s)	77, 530, 742, 919
AlwNI	CAGNNNCTG	1 cut(s)	1609
Ama87I	CYCGRG	1 cut(s)	1392
Aor13HI	TCCGGA	1 cut(s)	633
ApaLI	GTGCAC	1 cut(s)	1126
ApeKI	GCWGC	9 cut(s)	43, 812, 890, 929, 959, 1103, 1277, 1352, 1546
ApoI	RAATTY	4 cut(s)	51, 61, 1085, 1249
AsiGI	ACCGGT	1 cut(s)	901
AspS9I	GGNCC	1 cut(s)	631
AsuC2I	CCSGG	2 cut(s)	732, 1582
AsuHPI	GGTGA	1 cut(s)	854
AvaI	CYCGRG	1 cut(s)	1392
AvaII	GGWCC	1 cut(s)	631
AxyI	CCTNAGG	1 cut(s)	691
BaeGI	GKGCMC	1 cut(s)	1130
BbsI	GAAGAC	1 cut(s)	1544
Bbv12I	GWGCWC	2 cut(s)	354, 1130
BbvI	GCAGC	9 cut(s)	30, 799, 877, 941, 971, 1115, 1289, 1364, 1533
BccI	CCATC	3 cut(s)	1562, 1579, 1643
BcgI	CGANNNNNNTGC	2 cut(s)	1233, 1267
BciT130I	CCWGG	1 cut(s)	837
BciVI	GTATCC	1 cut(s)	935
BclI	TGATCA	1 cut(s)	7
BcnI	CCSGG	2 cut(s)	732, 1582
BcoDI	GTCTC	3 cut(s)	251, 1176, 1600
BfaI	CTAG	1 cut(s)	30
BfmI	CTRYAG	1 cut(s)	1299
BfuAI	ACCTGC	1 cut(s)	169
BfuI	GTATCC	1 cut(s)	935
BisI	GCNGC	9 cut(s)	44, 813, 891, 930, 960, 1104, 1278, 1353, 1547
BlsI	GCNGC	9 cut(s)	45, 814, 892, 931, 961, 1105, 1279, 1354, 1548
BmcAI	AGTACT	1 cut(s)	1510
Bme1390I	CCNGG	3 cut(s)	732, 837, 1582
Bme18I	GGWCC	1 cut(s)	631
BmeT110I	CYCGRG	1 cut(s)	1392
BmgBI	CACGTC	1 cut(s)	925
BmgT120I	GGNCC	1 cut(s)	631
BmiI	GGNNCC	1 cut(s)	1000
BmrFI	CCNGG	3 cut(s)	732, 837, 1582
BmsI	GCATC	6 cut(s)	269, 835, 902, 955, 1339, 1363
BpiI	GAAGAC	1 cut(s)	1544
BpmI	CTGGAG	2 cut(s)	858, 1631
BpuEI	CTTGAG	3 cut(s)	302, 368, 1400
BpuMI	CCSGG	2 cut(s)	732, 1582
BsaI	GGTCTC	1 cut(s)	251
BsaJI	CCNNGG	2 cut(s)	835, 1030
BsaWI	WCCGGW	2 cut(s)	633, 901
Bsc4I	CCNNNNNNNGG	1 cut(s)	908
Bse118I	RCCGGY	1 cut(s)	901
Bse1I	ACTGG	3 cut(s)	1000, 1455, 1614
Bse21I	CCTNAGG	1 cut(s)	691
Bse3DI	GCAATG	1 cut(s)	392
BseAI	TCCGGA	1 cut(s)	633
BseBI	CCWGG	1 cut(s)	837
BseDI	CCNNGG	2 cut(s)	835, 1030
BseGI	GGATG	1 cut(s)	1590
BseLI	CCNNNNNNNGG	1 cut(s)	908
BseMI	GCAATG	1 cut(s)	392
BseMII	CTCAG	2 cut(s)	262, 705
BseNI	ACTGG	3 cut(s)	1000, 1455, 1614
BseSI	GKGCMC	1 cut(s)	1130
BseXI	GCAGC	9 cut(s)	30, 799, 877, 941, 971, 1115, 1289, 1364, 1533
BsgI	GTGCAG	1 cut(s)	1227
BshTI	ACCGGT	1 cut(s)	901
BsiHKAI	GWGCWC	2 cut(s)	354, 1130
BsiHKCI	CYCGRG	1 cut(s)	1392
BsiSI	CCGG	4 cut(s)	634, 732, 902, 1582
BslFI	GGGAC	1 cut(s)	1283
BslI	CCNNNNNNNGG	1 cut(s)	908
BsmAI	GTCTC	3 cut(s)	251, 1176, 1600
BsmFI	GGGAC	1 cut(s)	1283
BsmI	GAATGC	1 cut(s)	1055
Bso31I	GGTCTC	1 cut(s)	251
BsoBI	CYCGRG	1 cut(s)	1392
Bsp1286I	GDGCHC	2 cut(s)	354, 1130
Bsp13I	TCCGGA	1 cut(s)	633
Bsp143I	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
BspACI	CCGC	2 cut(s)	660, 1091
BspCNI	CTCAG	2 cut(s)	261, 704
BspEI	TCCGGA	1 cut(s)	633
BspLI	GGNNCC	1 cut(s)	1000
BspMI	ACCTGC	1 cut(s)	169
BspPI	GGATC	4 cut(s)	77, 530, 742, 919
BspTNI	GGTCTC	1 cut(s)	251
BsrDI	GCAATG	1 cut(s)	392
BsrFI	RCCGGY	1 cut(s)	901
BsrI	ACTGG	3 cut(s)	1000, 1455, 1614
BssAI	RCCGGY	1 cut(s)	901
BssECI	CCNNGG	2 cut(s)	835, 1030
BssMI	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
BssT1I	CCWWGG	1 cut(s)	1030
Bst2UI	CCWGG	1 cut(s)	837
Bst4CI	ACNGT	5 cut(s)	128, 756, 1041, 1132, 1300
Bst6I	CTCTTC	1 cut(s)	507
BstAPI	GCANNNNNTGC	1 cut(s)	965
BstDEI	CTNAG	4 cut(s)	248, 627, 691, 1236
BstEII	GGTNACC	1 cut(s)	338
BstF5I	GGATG	1 cut(s)	1590
BstKTI	GATC	6 cut(s)	10, 85, 525, 737, 914, 1292
BstMAI	GTCTC	3 cut(s)	251, 1176, 1600
BstMBI	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
BstMWI	GCNNNNNNNGC	4 cut(s)	959, 965, 974, 1241
BstNI	CCWGG	1 cut(s)	837
BstPI	GGTNACC	1 cut(s)	338
BstSCI	CCNGG	3 cut(s)	730, 835, 1580
BstSFI	CTRYAG	1 cut(s)	1299
BstSLI	GKGCMC	1 cut(s)	1130
BstV1I	GCAGC	9 cut(s)	30, 799, 877, 941, 971, 1115, 1289, 1364, 1533
BstV2I	GAAGAC	1 cut(s)	1544
Bsu36I	CCTNAGG	1 cut(s)	691
BsuI	GTATCC	1 cut(s)	935
BtrI	CACGTC	1 cut(s)	925
BtsCI	GGATG	1 cut(s)	1590
BtsI	GCAGTG	2 cut(s)	1478, 1541
BtsIMutI	CAGTG	5 cut(s)	256, 1128, 1448, 1478, 1541
BveI	ACCTGC	1 cut(s)	169
CaiI	CAGNNNCTG	1 cut(s)	1609
Cfr10I	RCCGGY	1 cut(s)	901
Cfr13I	GGNCC	1 cut(s)	631
CseI	GACGC	1 cut(s)	164
Csp6I	GTAC	4 cut(s)	490, 581, 710, 1509
CspAI	ACCGGT	1 cut(s)	901
CviAII	CATG	1 cut(s)	361
CviQI	GTAC	4 cut(s)	490, 581, 710, 1509
DdeI	CTNAG	4 cut(s)	248, 627, 691, 1236
DpnI	GATC	6 cut(s)	9, 84, 524, 736, 913, 1291
DpnII	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
Eam1104I	CTCTTC	1 cut(s)	507
EarI	CTCTTC	1 cut(s)	507
Eco130I	CCWWGG	1 cut(s)	1030
Eco31I	GGTCTC	1 cut(s)	251
Eco47I	GGWCC	1 cut(s)	631
Eco57I	CTGAAG	1 cut(s)	1105
Eco81I	CCTNAGG	1 cut(s)	691
Eco88I	CYCGRG	1 cut(s)	1392
Eco91I	GGTNACC	1 cut(s)	338
EcoO65I	GGTNACC	1 cut(s)	338
EcoRI	GAATTC	1 cut(s)	1249
EcoRII	CCWGG	1 cut(s)	835
EcoT14I	CCWWGG	1 cut(s)	1030
ErhI	CCWWGG	1 cut(s)	1030
FaeI	CATG	1 cut(s)	364
FaqI	GGGAC	1 cut(s)	1283
FatI	CATG	1 cut(s)	360
FauNDI	CATATG	1 cut(s)	79
FbaI	TGATCA	1 cut(s)	7
FblI	GTMKAC	1 cut(s)	727
Fnu4HI	GCNGC	9 cut(s)	44, 813, 891, 930, 960, 1104, 1278, 1353, 1547
FokI	GGATG	1 cut(s)	1597
Fsp4HI	GCNGC	9 cut(s)	44, 813, 891, 930, 960, 1104, 1278, 1353, 1547
FspBI	CTAG	1 cut(s)	30
GluI	GCNGC	9 cut(s)	44, 813, 891, 930, 960, 1104, 1278, 1353, 1547
GsuI	CTGGAG	2 cut(s)	858, 1631
HapII	CCGG	4 cut(s)	634, 732, 902, 1582
HgaI	GACGC	1 cut(s)	164
Hin1II	CATG	1 cut(s)	364
HindIII	AAGCTT	1 cut(s)	596
HinfI	GANTC	4 cut(s)	19, 643, 793, 1593
HpaII	CCGG	4 cut(s)	634, 732, 902, 1582
HphI	GGTGA	1 cut(s)	854
Hpy166II	GTNNAC	5 cut(s)	490, 710, 728, 1128, 1385
Hpy188I	TCNGA	8 cut(s)	367, 824, 859, 922, 1158, 1219, 1567, 1605
Hpy188III	TCNNGA	6 cut(s)	203, 281, 634, 1174, 1268, 1287
Hpy8I	GTNNAC	5 cut(s)	490, 710, 728, 1128, 1385
HpyAV	CCTTC	4 cut(s)	476, 559, 1129, 1485
HpyCH4III	ACNGT	5 cut(s)	128, 756, 1041, 1132, 1300
HpyCH4IV	ACGT	1 cut(s)	924
HpyF10VI	GCNNNNNNNGC	4 cut(s)	959, 965, 974, 1241
HpyF3I	CTNAG	4 cut(s)	248, 627, 691, 1236
HpySE526I	ACGT	1 cut(s)	924
Hsp92II	CATG	1 cut(s)	364
Kpn2I	TCCGGA	1 cut(s)	633
Ksp22I	TGATCA	1 cut(s)	7
Kzo9I	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
Lsp1109I	GCAGC	9 cut(s)	30, 799, 877, 941, 971, 1115, 1289, 1364, 1533
LweI	GCATC	6 cut(s)	269, 835, 902, 955, 1339, 1363
MaeI	CTAG	1 cut(s)	30
MaeII	ACGT	1 cut(s)	924
MaeIII	GTNAC	4 cut(s)	338, 550, 1012, 1444
MalI	GATC	6 cut(s)	9, 84, 524, 736, 913, 1291
MboI	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
MhlI	GDGCHC	2 cut(s)	354, 1130
MlyI	GAGTC	2 cut(s)	28, 637
MmeI	TCCRAC	2 cut(s)	727, 1498
MroI	TCCGGA	1 cut(s)	633
MseI	TTAA	6 cut(s)	14, 477, 992, 1026, 1493, 1556
MslI	CAYNNNNRTG	1 cut(s)	359
MspA1I	CMGCKG	1 cut(s)	1106
MspI	CCGG	4 cut(s)	634, 732, 902, 1582
MspR9I	CCNGG	3 cut(s)	732, 837, 1582
Mva1269I	GAATGC	1 cut(s)	1055
MvaI	CCWGG	1 cut(s)	837
MwoI	GCNNNNNNNGC	4 cut(s)	959, 965, 974, 1241
NciI	CCSGG	2 cut(s)	732, 1582
NdeI	CATATG	1 cut(s)	79
NdeII	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
NlaIII	CATG	1 cut(s)	364
NlaIV	GGNNCC	1 cut(s)	1000
NmuCI	GTSAC	1 cut(s)	1012
PaqCI	CACCTGC	1 cut(s)	169
PctI	GAATGC	1 cut(s)	1055
PfeI	GAWTC	2 cut(s)	793, 1593
PflFI	GACNNNGTC	1 cut(s)	361
PinAI	ACCGGT	1 cut(s)	901
PkrI	GCNGC	9 cut(s)	45, 814, 892, 931, 961, 1105, 1279, 1354, 1548
PleI	GAGTC	2 cut(s)	27, 637
PpsI	GAGTC	2 cut(s)	27, 637
PsiI	TTATAA	1 cut(s)	1169
Psp6I	CCWGG	1 cut(s)	835
PspEI	GGTNACC	1 cut(s)	338
PspGI	CCWGG	1 cut(s)	835
PspN4I	GGNNCC	1 cut(s)	1000
PspPI	GGNCC	1 cut(s)	631
PstNI	CAGNNNCTG	1 cut(s)	1609
PsyI	GACNNNGTC	1 cut(s)	361
PvuII	CAGCTG	1 cut(s)	1106
RsaI	GTAC	4 cut(s)	491, 582, 711, 1510
RsaNI	GTAC	4 cut(s)	490, 581, 710, 1509
RseI	CAYNNNNRTG	1 cut(s)	359
SaqAI	TTAA	6 cut(s)	14, 477, 992, 1026, 1493, 1556
SatI	GCNGC	9 cut(s)	44, 813, 891, 930, 960, 1104, 1278, 1353, 1547
Sau3AI	GATC	6 cut(s)	7, 82, 522, 734, 911, 1289
Sau96I	GGNCC	1 cut(s)	631
ScaI	AGTACT	1 cut(s)	1510
SchI	GAGTC	2 cut(s)	28, 637
ScrFI	CCNGG	3 cut(s)	732, 837, 1582
SduI	GDGCHC	2 cut(s)	354, 1130
SfaNI	GCATC	6 cut(s)	269, 835, 902, 955, 1339, 1363
SfcI	CTRYAG	1 cut(s)	1299
SinI	GGWCC	1 cut(s)	631
SmiMI	CAYNNNNRTG	1 cut(s)	359
SmlI	CTYRAG	3 cut(s)	281, 347, 1415
SmoI	CTYRAG	3 cut(s)	281, 347, 1415
SsiI	CCGC	2 cut(s)	660, 1091
SspI	AATATT	2 cut(s)	182, 623
SspMI	CTAG	1 cut(s)	30
StyD4I	CCNGG	3 cut(s)	730, 835, 1580
StyI	CCWWGG	1 cut(s)	1030
TaaI	ACNGT	5 cut(s)	128, 756, 1041, 1132, 1300
TaiI	ACGT	1 cut(s)	927
TatI	WGTACW	2 cut(s)	580, 1508
TfiI	GAWTC	2 cut(s)	793, 1593
Tru1I	TTAA	6 cut(s)	14, 477, 992, 1026, 1493, 1556
Tru9I	TTAA	6 cut(s)	14, 477, 992, 1026, 1493, 1556
TscAI	CASTG	5 cut(s)	256, 1135, 1455, 1485, 1548
TseFI	GTSAC	1 cut(s)	1012
TseI	GCWGC	9 cut(s)	43, 812, 890, 929, 959, 1103, 1277, 1352, 1546
Tsp45I	GTSAC	1 cut(s)	1012
TspDTI	ATGAA	3 cut(s)	495, 748, 1550
TspGWI	ACGGA	2 cut(s)	761, 1605
TspRI	CASTG	5 cut(s)	256, 1135, 1455, 1485, 1548
Tth111I	GACNNNGTC	1 cut(s)	361
VneI	GTGCAC	1 cut(s)	1126
VpaK11BI	GGWCC	1 cut(s)	631
XapI	RAATTY	4 cut(s)	51, 61, 1085, 1249
XmiI	GTMKAC	1 cut(s)	727
XspI	CTAG	1 cut(s)	30
ZrmI	AGTACT	1 cut(s)	1510

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.