FvH4_6g14070

strictosidine

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
8621198 .. 8622075
878 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g14070.t1

Sequence Viewer

Length: 426 bp
ATGCGATATAATCCAGGATTAAAGACAGTTGAATTACTACTAAGTGGTTTACCTTTTGCAAATGGTGTAGCTACAAGCCTAGATGGTAATTTCGTGCTTGTATCCCAAACTACAAGCAAAAACATTTTAAGGTATTGGGTTCGAGGACCTAGAGTAGGTCAAAGCGAGATATTTACAACAACACAAGGCTATCCTGACAATATTAGGAGAAACATAAACGGAGAGTTTTGGGTTGCAGAGAATAGTGGCGGAAGAGGTAAAGCAGCCAAATTCGACACCAACGGGAACTTTATGGAAGCCATAGATGGGCTTAATCCAATTAGTCAAGCTCAACAATTTCGTGGCAGTCTTTGGATAGGCTCGATTAATTACAGTCATGCCCTCACTTACGTCATAATTATAGTCATTCATGTCATCACCCACTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

142

Amino Acids

15.6

Weight (kDa)

9.45

Isoelectric Point (pI)

24.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Str_synth PF03088 1 - 49 2.3e-11 Strictosidine synthase
SGL PF08450 1 - 102 7.3e-08 SMP-30/Gluconolactonase/LRE-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 249
AcsI RAATTY 1 cut(s) 269
AfiI CCNNNNNNNGG 2 cut(s) 155, 306
AgsI TTSAA 1 cut(s) 32
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 71, 329
AluI AGCT 2 cut(s) 71, 329
ApeKI GCWGC 1 cut(s) 263
ApoI RAATTY 1 cut(s) 269
AseI ATTAAT 1 cut(s) 366
AspS9I GGNCC 1 cut(s) 146
AsuHPI GGTGA 1 cut(s) 409
AvaII GGWCC 1 cut(s) 146
BbvI GCAGC 1 cut(s) 275
BccI CCATC 2 cut(s) 77, 299
BciT130I CCWGG 1 cut(s) 15
BciVI GTATCC 1 cut(s) 112
BfaI CTAG 2 cut(s) 80, 150
BfuI GTATCC 1 cut(s) 112
BisI GCNGC 1 cut(s) 264
BlsI GCNGC 1 cut(s) 265
Bme1390I CCNGG 1 cut(s) 15
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 146
BmrFI CCNGG 1 cut(s) 15
Bsc4I CCNNNNNNNGG 2 cut(s) 155, 306
BseBI CCWGG 1 cut(s) 15
BseLI CCNNNNNNNGG 2 cut(s) 155, 306
BseXI GCAGC 1 cut(s) 275
BslI CCNNNNNNNGG 2 cut(s) 155, 306
BspACI CCGC 1 cut(s) 249
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 2 cut(s) 28, 374
Bst6I CTCTTC 1 cut(s) 247
BstDEI CTNAG 1 cut(s) 41
BstENI CCTNNNNNAGG 1 cut(s) 153
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstV1I GCAGC 1 cut(s) 275
BsuI GTATCC 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 421
Cfr13I GGNCC 1 cut(s) 146
CviAII CATG 2 cut(s) 377, 410
CviJI RGCY 8 cut(s) 71, 78, 189, 266, 299, 310, 329, 360
CviKI_1 RGCY 8 cut(s) 71, 78, 189, 266, 299, 310, 329, 360
DdeI CTNAG 1 cut(s) 41
Eam1104I CTCTTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 247
EciI GGCGGA 1 cut(s) 264
Eco47I GGWCC 1 cut(s) 146
EcoNI CCTNNNNNAGG 1 cut(s) 153
EcoO109I RGGNCCY 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 2 cut(s) 380, 413
FaiI YATR 8 cut(s) 9, 215, 293, 302, 378, 395, 401, 411
FatI CATG 2 cut(s) 376, 409
Fnu4HI GCNGC 1 cut(s) 264
Fsp4HI GCNGC 1 cut(s) 264
FspBI CTAG 2 cut(s) 80, 150
GluI GCNGC 1 cut(s) 264
Hin1II CATG 2 cut(s) 380, 413
HphI GGTGA 1 cut(s) 409
Hpy166II GTNNAC 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 1 cut(s) 50
HpyCH4III ACNGT 2 cut(s) 28, 374
HpyCH4IV ACGT 1 cut(s) 390
HpyCH4V TGCA 2 cut(s) 59, 236
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 390
Hsp92II CATG 2 cut(s) 380, 413
LpnPI CCDG 2 cut(s) 27, 207
Lsp1109I GCAGC 1 cut(s) 275
MaeI CTAG 2 cut(s) 80, 150
MaeII ACGT 1 cut(s) 390
MboII GAAGA 1 cut(s) 264
MluCI AATT 7 cut(s) 32, 88, 269, 318, 335, 367, 396
MnlI CCTC 3 cut(s) 137, 248, 392
MseI TTAA 4 cut(s) 20, 128, 312, 366
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
NlaIII CATG 2 cut(s) 380, 413
PfoI TCCNGGA 1 cut(s) 13
PkrI GCNGC 1 cut(s) 265
PpuMI RGGWCCY 1 cut(s) 146
PshBI ATTAAT 1 cut(s) 366
Psp5II RGGWCCY 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspPI GGNCC 1 cut(s) 146
PspPPI RGGWCCY 1 cut(s) 146
SaqAI TTAA 4 cut(s) 20, 128, 312, 366
SatI GCNGC 1 cut(s) 264
Sau96I GGNCC 1 cut(s) 146
ScrFI CCNGG 1 cut(s) 15
SetI ASST 8 cut(s) 55, 73, 134, 151, 160, 259, 331, 393
SinI GGWCC 1 cut(s) 146
Sse9I AATT 7 cut(s) 32, 88, 269, 318, 335, 367, 396
SsiI CCGC 1 cut(s) 249
SspI AATATT 1 cut(s) 202
SspMI CTAG 2 cut(s) 80, 150
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 2 cut(s) 28, 374
TaiI ACGT 1 cut(s) 393
TaqI TCGA 3 cut(s) 142, 273, 362
TasI AATT 7 cut(s) 32, 88, 269, 318, 335, 367, 396
Tru1I TTAA 4 cut(s) 20, 128, 312, 366
Tru9I TTAA 4 cut(s) 20, 128, 312, 366
TseI GCWGC 1 cut(s) 263
TspDTI ATGAA 1 cut(s) 398
TspGWI ACGGA 1 cut(s) 234
VpaK11BI GGWCC 1 cut(s) 146
VspI ATTAAT 1 cut(s) 366
XagI CCTNNNNNAGG 1 cut(s) 153
XapI RAATTY 1 cut(s) 269
XspI CTAG 2 cut(s) 80, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.