Rmu_sc0001193.1_g000011

strictosidine

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001193.1
Physical Location & Seq
Forward (+)
62401 .. 63384
984 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001193.1_g000011.1.cds

Sequence Viewer

Length: 984 bp
atgagtgtgagatcaagtttcgtggttttctcgtttttctttttggttacaatagcctcatctatttctcaagcagaagctctttcaattggtggttttgaacaccatgaaattcctgttccggtagttggccctgagagtgtggcgtttgactgcagcggagcagcctacgtcggggttgcggacgggcggatttttaaatggcttgggaggcaatatggatgggcggagtttgccacaacctccccatctaggccaagagcattgtgcgacggctccaccaacaaagacaatgagccaacttgtgggagacccctcggcctcaagttccaccccaccacatgcgagctttacatagccgatgcctatttcgggctcttgaagacaggacctaacggcggggtagcccgacaacttgcaacttcagcagaaggaatcccttttcagtttacaaattctgtggatattaatcccgtaactggaatggtttatttcacagattcaagctcggtttatcaaagaaggaattgggagtcgtcattcaacaccggtgacaaaactggaagactaatgagatataatccaagtgcaaaccgcgtggaagttttgctccgtggtttgtcttttgcaaatggtgtagctgtgagtctcgatggtaatttcgttctagtaacccaaacaacaagcaaaaacattctaaggtattgggttcgaggaccaagagctacgaattcaggtgtaggagaactttttgcacaaacacaaggcttccctgacaatattaacagaaacataaacggagagttttgggttgcagagaatagtaatggaagaggtaaagcagccaagttcgatgcctacgggaacttcatggaagccttggatgggcttaatcctattagccatgcccaagaatttcatcataatctttggataggttcgattgtcaacccctttgtgggcgttgttcgcaacatttattaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

327

Amino Acids

35.75

Weight (kDa)

7.01

Isoelectric Point (pI)

26.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 305
AccII CGCG 1 cut(s) 597
AciI CCGC 6 cut(s) 159, 182, 190, 227, 399, 595
AcsI RAATTY 4 cut(s) 111, 454, 730, 914
AcuI CTGAAG 1 cut(s) 408
AgeI ACCGGT 1 cut(s) 548
AgsI TTSAA 5 cut(s) 87, 101, 382, 504, 544
AluBI AGCT 5 cut(s) 80, 349, 507, 641, 725
AluI AGCT 5 cut(s) 80, 349, 507, 641, 725
Alw26I GTCTC 2 cut(s) 304, 653
AoxI GGCC 3 cut(s) 130, 254, 319
ApeKI GCWGC 3 cut(s) 156, 164, 842
ApoI RAATTY 4 cut(s) 111, 454, 730, 914
AseI ATTAAT 1 cut(s) 468
AsiGI ACCGGT 1 cut(s) 548
AspS9I GGNCC 3 cut(s) 131, 389, 716
AsuHPI GGTGA 1 cut(s) 563
AvaII GGWCC 2 cut(s) 389, 716
BanII GRGCYC 1 cut(s) 378
BbsI GAAGAC 2 cut(s) 389, 571
BbvI GCAGC 3 cut(s) 168, 176, 854
BccI CCATC 4 cut(s) 216, 256, 647, 878
BceAI ACGGC 2 cut(s) 289, 412
BcoDI GTCTC 2 cut(s) 304, 653
BfaI CTAG 2 cut(s) 252, 668
BfmI CTRYAG 1 cut(s) 154
BisI GCNGC 3 cut(s) 157, 165, 843
BlsI GCNGC 3 cut(s) 158, 166, 844
Bme18I GGWCC 2 cut(s) 389, 716
BmgT120I GGNCC 3 cut(s) 131, 389, 716
BmiI GGNNCC 1 cut(s) 277
BmsI GCATC 2 cut(s) 352, 844
BpiI GAAGAC 2 cut(s) 389, 571
BpuEI CTTGAG 2 cut(s) 54, 308
BsaBI GATNNNNATC 1 cut(s) 468
BsaI GGTCTC 1 cut(s) 304
BsaJI CCNNGG 3 cut(s) 316, 613, 879
BsaWI WCCGGW 2 cut(s) 121, 548
Bse118I RCCGGY 1 cut(s) 548
Bse1I ACTGG 2 cut(s) 484, 565
Bse8I GATNNNNATC 1 cut(s) 468
BseDI CCNNGG 3 cut(s) 316, 613, 879
BseGI GGATG 2 cut(s) 227, 889
BseJI GATNNNNATC 1 cut(s) 468
BseMII CTCAG 1 cut(s) 126
BseNI ACTGG 2 cut(s) 484, 565
BseXI GCAGC 3 cut(s) 168, 176, 854
Bsh1236I CGCG 1 cut(s) 597
BshFI GGCC 3 cut(s) 132, 256, 321
BshTI ACCGGT 1 cut(s) 548
BsiSI CCGG 2 cut(s) 122, 549
BsmAI GTCTC 2 cut(s) 304, 653
BsnI GGCC 3 cut(s) 132, 256, 321
Bso31I GGTCTC 1 cut(s) 304
Bsp1286I GDGCHC 1 cut(s) 378
Bsp143I GATC 1 cut(s) 11
BspACI CCGC 6 cut(s) 159, 182, 190, 227, 399, 595
BspANI GGCC 3 cut(s) 132, 256, 321
BspCNI CTCAG 1 cut(s) 127
BspFNI CGCG 1 cut(s) 597
BspLI GGNNCC 1 cut(s) 277
BspMAI CTGCAG 1 cut(s) 158
BspTNI GGTCTC 1 cut(s) 304
BsrFI RCCGGY 1 cut(s) 548
BsrI ACTGG 2 cut(s) 484, 565
BssAI RCCGGY 1 cut(s) 548
BssECI CCNNGG 3 cut(s) 316, 613, 879
BssMI GATC 1 cut(s) 11
BssT1I CCWWGG 1 cut(s) 879
Bst6I CTCTTC 1 cut(s) 826
BstC8I GCNNGC 1 cut(s) 347
BstDEI CTNAG 2 cut(s) 135, 698
BstDSI CCRYGG 1 cut(s) 613
BstF5I GGATG 2 cut(s) 227, 889
BstFNI CGCG 1 cut(s) 597
BstKTI GATC 1 cut(s) 14
BstMAI GTCTC 2 cut(s) 304, 653
BstMBI GATC 1 cut(s) 11
BstMWI GCNNNNNNNGC 4 cut(s) 211, 233, 425, 969
BstNSI RCATGY 1 cut(s) 345
BstSFI CTRYAG 1 cut(s) 154
BstUI CGCG 1 cut(s) 597
BstV1I GCAGC 3 cut(s) 168, 176, 854
BstV2I GAAGAC 2 cut(s) 389, 571
BsuRI GGCC 3 cut(s) 132, 256, 321
BtgI CCRYGG 1 cut(s) 613
BtsCI GGATG 2 cut(s) 227, 889
Cac8I GCNNGC 1 cut(s) 347
Cfr10I RCCGGY 1 cut(s) 548
Cfr13I GGNCC 3 cut(s) 131, 389, 716
CspAI ACCGGT 1 cut(s) 548
CspCI CAANNNNNGTGG 5 cut(s) 38, 441, 476, 579, 614
CviAII CATG 4 cut(s) 107, 342, 871, 905
DdeI CTNAG 2 cut(s) 135, 698
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
DraI TTTAAA 1 cut(s) 199
Eam1104I CTCTTC 1 cut(s) 826
EarI CTCTTC 1 cut(s) 826
EciI GGCGGA 2 cut(s) 205, 242
Eco130I CCWWGG 1 cut(s) 879
Eco24I GRGCYC 1 cut(s) 378
Eco31I GGTCTC 1 cut(s) 304
Eco47I GGWCC 2 cut(s) 389, 716
Eco57I CTGAAG 1 cut(s) 408
EcoO109I RGGNCCY 1 cut(s) 389
EcoRI GAATTC 1 cut(s) 730
EcoT14I CCWWGG 1 cut(s) 879
EcoT38I GRGCYC 1 cut(s) 378
ErhI CCWWGG 1 cut(s) 879
FaeI CATG 4 cut(s) 110, 345, 874, 908
FaiI YATR 9 cut(s) 108, 219, 343, 356, 579, 794, 872, 906, 924
FatI CATG 4 cut(s) 106, 341, 870, 904
FauI CCCGC 1 cut(s) 392
Fnu4HI GCNGC 3 cut(s) 157, 165, 843
FokI GGATG 2 cut(s) 234, 896
FriOI GRGCYC 1 cut(s) 378
Fsp4HI GCNGC 3 cut(s) 157, 165, 843
FspBI CTAG 2 cut(s) 252, 668
GluI GCNGC 3 cut(s) 157, 165, 843
HaeIII GGCC 3 cut(s) 132, 256, 321
HapII CCGG 2 cut(s) 122, 549
Hin1II CATG 4 cut(s) 110, 345, 874, 908
HincII GTYRAC 1 cut(s) 949
HindII GTYRAC 1 cut(s) 949
HinfI GANTC 4 cut(s) 435, 500, 533, 646
HpaII CCGG 2 cut(s) 122, 549
HphI GGTGA 1 cut(s) 563
Hpy166II GTNNAC 2 cut(s) 450, 949
Hpy188III TCNNGA 2 cut(s) 379, 650
Hpy8I GTNNAC 2 cut(s) 450, 949
Hpy99I CGWCG 2 cut(s) 176, 275
HpyAV CCTTC 2 cut(s) 425, 516
HpyCH4IV ACGT 1 cut(s) 171
HpyCH4V TGCA 6 cut(s) 156, 419, 590, 629, 755, 815
HpyF10VI GCNNNNNNNGC 4 cut(s) 211, 233, 425, 969
HpyF3I CTNAG 2 cut(s) 135, 698
HpySE526I ACGT 1 cut(s) 171
Hsp92II CATG 4 cut(s) 110, 345, 874, 908
Kzo9I GATC 1 cut(s) 11
LmnI GCTCC 3 cut(s) 161, 281, 615
LpnPI CCDG 9 cut(s) 129, 135, 147, 372, 465, 546, 562, 720, 786
Lsp1109I GCAGC 3 cut(s) 168, 176, 854
LweI GCATC 2 cut(s) 352, 844
MaeI CTAG 2 cut(s) 252, 668
MaeII ACGT 1 cut(s) 171
MaeIII GTNAC 4 cut(s) 46, 475, 551, 670
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 3 cut(s) 394, 576, 843
MfeI CAATTG 1 cut(s) 87
MhlI GDGCHC 1 cut(s) 378
MluCI AATT 7 cut(s) 87, 111, 454, 526, 658, 730, 914
MlyI GAGTC 2 cut(s) 542, 655
MnlI CCTC 7 cut(s) 67, 204, 253, 326, 332, 707, 827
MseI TTAA 5 cut(s) 198, 468, 783, 891, 982
MspA1I CMGCKG 1 cut(s) 159
MspI CCGG 2 cut(s) 122, 549
MunI CAATTG 1 cut(s) 87
MvnI CGCG 1 cut(s) 597
MwoI GCNNNNNNNGC 4 cut(s) 211, 233, 425, 969
NdeII GATC 1 cut(s) 11
NlaIII CATG 4 cut(s) 110, 345, 874, 908
NlaIV GGNNCC 1 cut(s) 277
NmeAIII GCCGAG 1 cut(s) 297
NmuCI GTSAC 1 cut(s) 551
NspI RCATGY 1 cut(s) 345
PfeI GAWTC 2 cut(s) 435, 500
PflMI CCANNNNNTGG 1 cut(s) 305
PinAI ACCGGT 1 cut(s) 548
PkrI GCNGC 3 cut(s) 158, 166, 844
PleI GAGTC 2 cut(s) 541, 654
PpsI GAGTC 2 cut(s) 541, 654
PpuMI RGGWCCY 1 cut(s) 389
PshBI ATTAAT 1 cut(s) 468
Psp5II RGGWCCY 1 cut(s) 389
PspN4I GGNNCC 1 cut(s) 277
PspPI GGNCC 3 cut(s) 131, 389, 716
PspPPI RGGWCCY 1 cut(s) 389
PstI CTGCAG 1 cut(s) 158
SaqAI TTAA 5 cut(s) 198, 468, 783, 891, 982
SatI GCNGC 3 cut(s) 157, 165, 843
Sau3AI GATC 1 cut(s) 11
Sau96I GGNCC 3 cut(s) 131, 389, 716
SchI GAGTC 2 cut(s) 542, 655
SduI GDGCHC 1 cut(s) 378
SfaNI GCATC 2 cut(s) 352, 844
SfcI CTRYAG 1 cut(s) 154
SgrAI CRCCGGYG 1 cut(s) 548
SinI GGWCC 2 cut(s) 389, 716
SmlI CTYRAG 2 cut(s) 69, 323
SmoI CTYRAG 2 cut(s) 69, 323
Sse9I AATT 7 cut(s) 87, 111, 454, 526, 658, 730, 914
SsiI CCGC 6 cut(s) 159, 182, 190, 227, 399, 595
SspI AATATT 1 cut(s) 781
SspMI CTAG 2 cut(s) 252, 668
StyI CCWWGG 1 cut(s) 879
TaiI ACGT 1 cut(s) 174
TaqI TCGA 4 cut(s) 651, 712, 852, 941
TasI AATT 7 cut(s) 87, 111, 454, 526, 658, 730, 914
TfiI GAWTC 2 cut(s) 435, 500
Tru1I TTAA 5 cut(s) 198, 468, 783, 891, 982
Tru9I TTAA 5 cut(s) 198, 468, 783, 891, 982
TseFI GTSAC 1 cut(s) 551
TseI GCWGC 3 cut(s) 156, 164, 842
Tsp45I GTSAC 1 cut(s) 551
TspDTI ATGAA 3 cut(s) 123, 859, 908
TspGWI ACGGA 2 cut(s) 602, 813
Van91I CCANNNNNTGG 1 cut(s) 305
VpaK11BI GGWCC 2 cut(s) 389, 716
VspI ATTAAT 1 cut(s) 468
XapI RAATTY 4 cut(s) 111, 454, 730, 914
XceI RCATGY 1 cut(s) 345
XspI CTAG 2 cut(s) 252, 668
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.