RchiOBHm_Chr1g0318201

strictosidine

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000674
Physical Location & Seq
Forward (+)
5656310 .. 5656537
228 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54849

Sequence Viewer

Length: 228 bp
ATGCGATATGATCCATGGACAAAGAATGTGACTGTGTTGCGTGATGACTTGTCTTTTGCAAATGGGGTGGCACTAAGCAAAGACGGTGATTTTGTGCTAGTAACCCAAACCACCGCAAAGAACATTTTGAGGTACTGGCTTCGAGGGCCTAGAGCCAACACTGTTGATATTTTTTTCCAACTGCGAGGAGCCCCAGACAATATCATCCGAAACATAAATGGAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Str_synth

Protein Analysis

75

Amino Acids

8.57

Weight (kDa)

9.39

Isoelectric Point (pI)

24.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Str_synth PF03088 1 - 49 7e-17 Strictosidine synthase
SGL PF08450 2 - 62 9e-06 SMP-30/Gluconolactonase/LRE-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 114
AclWI GGATC 1 cut(s) 5
AfaI GTAC 1 cut(s) 134
AlwI GGATC 1 cut(s) 5
AoxI GGCC 1 cut(s) 146
ArsI GACNNNNNNTTYG 4 cut(s) 38, 70, 74, 106
AspS9I GGNCC 1 cut(s) 146
AsuHPI GGTGA 1 cut(s) 98
BanII GRGCYC 1 cut(s) 193
BfaI CTAG 2 cut(s) 98, 150
BmgT120I GGNCC 1 cut(s) 146
BmiI GGNNCC 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 14
Bse1I ACTGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 14
BseGI GGATG 1 cut(s) 204
BseNI ACTGG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 201
BshFI GGCC 1 cut(s) 148
BsnI GGCC 1 cut(s) 148
Bsp1286I GDGCHC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 10
Bsp19I CCATGG 1 cut(s) 14
BspACI CCGC 1 cut(s) 114
BspANI GGCC 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 190
BspPI GGATC 1 cut(s) 5
BsrI ACTGG 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 14
BssMI GATC 1 cut(s) 10
BssT1I CCWWGG 1 cut(s) 14
Bst4CI ACNGT 3 cut(s) 34, 86, 163
BstDEI CTNAG 1 cut(s) 74
BstDSI CCRYGG 1 cut(s) 14
BstF5I GGATG 1 cut(s) 204
BstKTI GATC 1 cut(s) 13
BstMBI GATC 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 148
BtgI CCRYGG 1 cut(s) 14
BtsCI GGATG 1 cut(s) 204
BtsIMutI CAGTG 1 cut(s) 159
Cfr13I GGNCC 1 cut(s) 146
Csp6I GTAC 1 cut(s) 133
CspCI CAANNNNNGTGG 2 cut(s) 48, 83
CviAII CATG 1 cut(s) 15
CviJI RGCY 4 cut(s) 139, 148, 155, 191
CviKI_1 RGCY 4 cut(s) 139, 148, 155, 191
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 1 cut(s) 74
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 14
Eco24I GRGCYC 1 cut(s) 193
EcoO109I RGGNCCY 1 cut(s) 146
EcoT14I CCWWGG 1 cut(s) 14
EcoT38I GRGCYC 1 cut(s) 193
ErhI CCWWGG 1 cut(s) 14
FaeI CATG 1 cut(s) 18
FaiI YATR 3 cut(s) 9, 16, 215
FatI CATG 1 cut(s) 14
FokI GGATG 1 cut(s) 191
FriOI GRGCYC 1 cut(s) 193
FspBI CTAG 2 cut(s) 98, 150
HaeIII GGCC 1 cut(s) 148
Hin1II CATG 1 cut(s) 18
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 209
HpyCH4III ACNGT 3 cut(s) 34, 86, 163
HpyCH4V TGCA 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 1 cut(s) 18
Kzo9I GATC 1 cut(s) 10
LmnI GCTCC 1 cut(s) 188
LpnPI CCDG 2 cut(s) 121, 207
MaeI CTAG 2 cut(s) 98, 150
MaeIII GTNAC 2 cut(s) 28, 100
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MhlI GDGCHC 1 cut(s) 193
MmeI TCCRAC 1 cut(s) 202
MnlI CCTC 3 cut(s) 123, 137, 179
MwoI GCNNNNNNNGC 1 cut(s) 145
NcoI CCATGG 1 cut(s) 14
NdeII GATC 1 cut(s) 10
NlaIII CATG 1 cut(s) 18
NlaIV GGNNCC 1 cut(s) 190
NmuCI GTSAC 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 190
PspPI GGNCC 1 cut(s) 146
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
Sau3AI GATC 1 cut(s) 10
Sau96I GGNCC 1 cut(s) 146
SduI GDGCHC 1 cut(s) 193
SetI ASST 1 cut(s) 134
SgeI CNNG 9 cut(s) 27, 53, 61, 110, 148, 155, 162, 197, 206
SsiI CCGC 1 cut(s) 114
SspMI CTAG 2 cut(s) 98, 150
StyI CCWWGG 1 cut(s) 14
TaaI ACNGT 3 cut(s) 34, 86, 163
TaqI TCGA 1 cut(s) 142
TscAI CASTG 1 cut(s) 166
TseFI GTSAC 1 cut(s) 28
Tsp45I GTSAC 1 cut(s) 28
TspRI CASTG 1 cut(s) 166
XspI CTAG 2 cut(s) 98, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.