Rmu_sc0008182.1_g000002

strictosidine

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008182.1
OG0000674
Physical Location & Seq
Reverse (-)
7419 .. 8312
894 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008182.1_g000002.1.cds

Sequence Viewer

Length: 894 bp
ttttcactcccaaacctaaaccatcatgaaatacccatccatgtaccgcagcccgaaagcattgcttttgactgcaatggcgcaccctacgtgggtgtggctgatggcaggatattcaagtggctaggataccctcttgggtggagagaattcgcagtcaccgcctccaataggccgagaggagtatgtgatttaacaaccaacaaagacaatgaaccgatatgcgggaggccacttggtttaaaattcgacctcacaacatgtgaactgtatatcgcagatgcctattttgggcttctgaagacaggaccaaatggtggagtagctcaaatacttgcgacatctgctgaaggagttcctttccgtttcttaaacggtgtcgacattgatcgccaaagtggaatggtgtacttcacagacaccagtgctatttaccagagaagaaattgggaattgtcagttagtacaggtgataaaactggaaggttaatgcgatatgatccatggacaaagaatgtcactgtgttgcgtcatgacttgtcttttgcaaacggggtggcactaagcaaagacggtgattttgtgctagtaacccaaaccaatgcaaagaacattttgaggtattggcttcgagggcctagagccaacactgttgatatttttttccaactgcaaggagccccggacaatatcatcagaaacataaatggagaattttgggttgcagaaaatagtgccggaaaaggtaaagcggtcaggcttgacgctcaaggaaactttctagacgtggtggatggactcaaccctgtgagtcatgttgaacagcgttatagaaacctttggataggatctgtggttaataactttgttggggttattcttaattttgtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Str_synth

Protein Analysis

297

Amino Acids

33.04

Weight (kDa)

7.12

Isoelectric Point (pI)

22.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 317
AccI GTMKAC 1 cut(s) 381
AciI CCGC 4 cut(s) 47, 162, 225, 752
AclWI GGATC 2 cut(s) 494, 856
AcsI RAATTY 3 cut(s) 149, 245, 713
AcuI CTGAAG 2 cut(s) 320, 369
AfaI GTAC 3 cut(s) 45, 410, 466
AfiI CCNNNNNNNGG 5 cut(s) 92, 171, 224, 291, 317
AflIII ACRYGT 1 cut(s) 260
AgsI TTSAA 2 cut(s) 118, 821
AjiI CACGTC 1 cut(s) 787
AluBI AGCT 1 cut(s) 326
AluI AGCT 1 cut(s) 326
AlwI GGATC 2 cut(s) 494, 856
AoxI GGCC 3 cut(s) 173, 230, 635
ApeKI GCWGC 1 cut(s) 49
ApoI RAATTY 3 cut(s) 149, 245, 713
ArsI GACNNNNNNTTYG 4 cut(s) 527, 559, 563, 595
Asp700I GAANNNNTTC 1 cut(s) 354
AspLEI GCGC 1 cut(s) 83
AspS9I GGNCC 2 cut(s) 308, 635
AsuC2I CCSGG 1 cut(s) 683
AsuHPI GGTGA 3 cut(s) 151, 482, 587
AvaII GGWCC 1 cut(s) 308
BanII GRGCYC 1 cut(s) 682
BbsI GAAGAC 1 cut(s) 308
BbvI GCAGC 1 cut(s) 61
BccI CCATC 4 cut(s) 30, 44, 98, 788
BcgI CGANNNNNNTGC 2 cut(s) 44, 78
BciVI GTATCC 1 cut(s) 122
BcnI CCSGG 1 cut(s) 683
BfaI CTAG 4 cut(s) 125, 587, 639, 782
BfuI GTATCC 1 cut(s) 122
BisI GCNGC 1 cut(s) 50
BlsI GCNGC 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 683
Bme18I GGWCC 1 cut(s) 308
BmgBI CACGTC 1 cut(s) 787
BmgT120I GGNCC 2 cut(s) 308, 635
BmiI GGNNCC 1 cut(s) 679
BmrFI CCNGG 1 cut(s) 683
BmsI GCATC 1 cut(s) 271
BpiI GAAGAC 1 cut(s) 308
BpuEI CTTGAG 1 cut(s) 753
BpuMI CCSGG 1 cut(s) 683
BsaAI YACGTR 1 cut(s) 91
BsaJI CCNNGG 2 cut(s) 503, 681
Bsc4I CCNNNNNNNGG 5 cut(s) 92, 171, 224, 291, 317
Bse1I ACTGG 2 cut(s) 423, 484
Bse3DI GCAATG 2 cut(s) 60, 82
BseDI CCNNGG 2 cut(s) 503, 681
BseGI GGATG 2 cut(s) 36, 799
BseLI CCNNNNNNNGG 5 cut(s) 92, 171, 224, 291, 317
BseMI GCAATG 2 cut(s) 60, 82
BseNI ACTGG 2 cut(s) 423, 484
BseRI GAGGAG 1 cut(s) 195
BseXI GCAGC 1 cut(s) 61
BshFI GGCC 3 cut(s) 175, 232, 637
BsiSI CCGG 2 cut(s) 683, 738
BslI CCNNNNNNNGG 5 cut(s) 92, 171, 224, 291, 317
BsnI GGCC 3 cut(s) 175, 232, 637
Bsp1286I GDGCHC 1 cut(s) 682
Bsp143I GATC 3 cut(s) 388, 499, 848
Bsp19I CCATGG 1 cut(s) 503
BspACI CCGC 4 cut(s) 47, 162, 225, 752
BspANI GGCC 3 cut(s) 175, 232, 637
BspHI TCATGA 2 cut(s) 25, 532
BspLI GGNNCC 1 cut(s) 679
BspPI GGATC 2 cut(s) 494, 856
BsrDI GCAATG 2 cut(s) 60, 82
BsrI ACTGG 2 cut(s) 423, 484
BssECI CCNNGG 2 cut(s) 503, 681
BssMI GATC 3 cut(s) 388, 499, 848
BssT1I CCWWGG 1 cut(s) 503
Bst4CI ACNGT 5 cut(s) 270, 377, 523, 575, 652
BstBAI YACGTR 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 563
BstDSI CCRYGG 1 cut(s) 503
BstENI CCTNNNNNAGG 1 cut(s) 169
BstF5I GGATG 2 cut(s) 36, 799
BstHHI GCGC 1 cut(s) 83
BstKTI GATC 3 cut(s) 391, 502, 851
BstMBI GATC 3 cut(s) 388, 499, 848
BstMWI GCNNNNNNNGC 3 cut(s) 161, 344, 634
BstNSI RCATGY 1 cut(s) 264
BstSCI CCNGG 1 cut(s) 681
BstV1I GCAGC 1 cut(s) 61
BstV2I GAAGAC 1 cut(s) 308
BstX2I RGATCY 1 cut(s) 848
BstYI RGATCY 1 cut(s) 848
BsuI GTATCC 1 cut(s) 122
BsuRI GGCC 3 cut(s) 175, 232, 637
BtgI CCRYGG 1 cut(s) 503
BtrI CACGTC 1 cut(s) 787
BtsCI GGATG 2 cut(s) 36, 799
BtsIMutI CAGTG 3 cut(s) 430, 519, 648
CciI TCATGA 2 cut(s) 25, 532
CfoI GCGC 1 cut(s) 83
Cfr13I GGNCC 2 cut(s) 308, 635
CseI GACGC 2 cut(s) 518, 773
Csp6I GTAC 3 cut(s) 44, 409, 465
CspCI CAANNNNNGTGG 2 cut(s) 537, 572
CviAII CATG 6 cut(s) 26, 41, 261, 504, 533, 815
CviQI GTAC 3 cut(s) 44, 409, 465
DdeI CTNAG 1 cut(s) 563
DpnI GATC 3 cut(s) 390, 501, 850
DpnII GATC 3 cut(s) 388, 499, 848
DraI TTTAAA 1 cut(s) 243
Eco130I CCWWGG 1 cut(s) 503
Eco24I GRGCYC 1 cut(s) 682
Eco47I GGWCC 1 cut(s) 308
Eco57I CTGAAG 2 cut(s) 320, 369
EcoNI CCTNNNNNAGG 1 cut(s) 169
EcoO109I RGGNCCY 1 cut(s) 635
EcoRI GAATTC 1 cut(s) 149
EcoT14I CCWWGG 1 cut(s) 503
EcoT38I GRGCYC 1 cut(s) 682
ErhI CCWWGG 1 cut(s) 503
FaeI CATG 6 cut(s) 29, 44, 264, 507, 536, 818
FalI AAGNNNNNCTT 2 cut(s) 49, 81
FatI CATG 6 cut(s) 25, 40, 260, 503, 532, 814
FauI CCCGC 1 cut(s) 218
FblI GTMKAC 1 cut(s) 381
Fnu4HI GCNGC 1 cut(s) 50
FokI GGATG 2 cut(s) 23, 806
FriOI GRGCYC 1 cut(s) 682
Fsp4HI GCNGC 1 cut(s) 50
FspBI CTAG 4 cut(s) 125, 587, 639, 782
GlaI GCGC 1 cut(s) 82
GluI GCNGC 1 cut(s) 50
HaeIII GGCC 3 cut(s) 175, 232, 637
HapII CCGG 2 cut(s) 683, 738
HgaI GACGC 2 cut(s) 518, 773
HhaI GCGC 1 cut(s) 83
Hin1II CATG 6 cut(s) 29, 44, 264, 507, 536, 818
Hin6I GCGC 1 cut(s) 81
HinP1I GCGC 1 cut(s) 81
HincII GTYRAC 1 cut(s) 382
HindII GTYRAC 1 cut(s) 382
HinfI GANTC 2 cut(s) 798, 811
HpaII CCGG 2 cut(s) 683, 738
HphI GGTGA 3 cut(s) 151, 482, 587
Hpy166II GTNNAC 3 cut(s) 266, 382, 409
Hpy188I TCNGA 2 cut(s) 300, 698
Hpy188III TCNNGA 3 cut(s) 26, 533, 782
Hpy8I GTNNAC 3 cut(s) 266, 382, 409
HpyAV CCTTC 2 cut(s) 344, 477
HpyCH4III ACNGT 5 cut(s) 270, 377, 523, 575, 652
HpyCH4IV ACGT 2 cut(s) 90, 786
HpyCH4V TGCA 5 cut(s) 75, 548, 605, 673, 725
HpyF10VI GCNNNNNNNGC 3 cut(s) 161, 344, 634
HpyF3I CTNAG 1 cut(s) 563
HpySE526I ACGT 2 cut(s) 90, 786
Hsp92II CATG 6 cut(s) 29, 44, 264, 507, 536, 818
HspAI GCGC 1 cut(s) 81
Kzo9I GATC 3 cut(s) 388, 499, 848
LmnI GCTCC 1 cut(s) 677
Lsp1109I GCAGC 1 cut(s) 61
LweI GCATC 1 cut(s) 271
MaeI CTAG 4 cut(s) 125, 587, 639, 782
MaeII ACGT 2 cut(s) 90, 786
MaeIII GTNAC 3 cut(s) 157, 517, 589
MalI GATC 3 cut(s) 390, 501, 850
MboI GATC 3 cut(s) 388, 499, 848
MboII GAAGA 2 cut(s) 313, 453
MflI RGATCY 1 cut(s) 848
MhlI GDGCHC 1 cut(s) 682
MluCI AATT 6 cut(s) 149, 245, 445, 452, 713, 883
MlyI GAGTC 2 cut(s) 792, 820
MmeI TCCRAC 1 cut(s) 691
MnlI CCTC 7 cut(s) 144, 173, 175, 222, 263, 612, 626
MroXI GAANNNNTTC 1 cut(s) 354
MseI TTAA 6 cut(s) 194, 242, 371, 488, 858, 882
MspI CCGG 2 cut(s) 683, 738
MspR9I CCNGG 1 cut(s) 683
MwoI GCNNNNNNNGC 3 cut(s) 161, 344, 634
NciI CCSGG 1 cut(s) 683
NcoI CCATGG 1 cut(s) 503
NdeII GATC 3 cut(s) 388, 499, 848
NlaIII CATG 6 cut(s) 29, 44, 264, 507, 536, 818
NlaIV GGNNCC 1 cut(s) 679
NmeAIII GCCGAG 1 cut(s) 201
NmuCI GTSAC 2 cut(s) 157, 517
NspI RCATGY 1 cut(s) 264
PagI TCATGA 2 cut(s) 25, 532
PciI ACATGT 1 cut(s) 260
PdmI GAANNNNTTC 1 cut(s) 354
PflMI CCANNNNNTGG 1 cut(s) 317
PkrI GCNGC 1 cut(s) 51
PleI GAGTC 2 cut(s) 792, 819
PpsI GAGTC 2 cut(s) 792, 819
Ppu21I YACGTR 1 cut(s) 91
PscI ACATGT 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 679
PspPI GGNCC 2 cut(s) 308, 635
PsuI RGATCY 1 cut(s) 848
RsaI GTAC 3 cut(s) 45, 410, 466
RsaNI GTAC 3 cut(s) 44, 409, 465
SalI GTCGAC 1 cut(s) 380
SaqAI TTAA 6 cut(s) 194, 242, 371, 488, 858, 882
SatI GCNGC 1 cut(s) 50
Sau3AI GATC 3 cut(s) 388, 499, 848
Sau96I GGNCC 2 cut(s) 308, 635
SchI GAGTC 2 cut(s) 792, 820
ScrFI CCNGG 1 cut(s) 683
SduI GDGCHC 1 cut(s) 682
SfaNI GCATC 1 cut(s) 271
SinI GGWCC 1 cut(s) 308
SmlI CTYRAG 1 cut(s) 768
SmoI CTYRAG 1 cut(s) 768
Sse9I AATT 6 cut(s) 149, 245, 445, 452, 713, 883
SsiI CCGC 4 cut(s) 47, 162, 225, 752
SspMI CTAG 4 cut(s) 125, 587, 639, 782
StyD4I CCNGG 1 cut(s) 681
StyI CCWWGG 1 cut(s) 503
TaaI ACNGT 5 cut(s) 270, 377, 523, 575, 652
TaiI ACGT 2 cut(s) 93, 789
TaqI TCGA 3 cut(s) 249, 381, 631
TasI AATT 6 cut(s) 149, 245, 445, 452, 713, 883
TatI WGTACW 2 cut(s) 408, 464
Tru1I TTAA 6 cut(s) 194, 242, 371, 488, 858, 882
Tru9I TTAA 6 cut(s) 194, 242, 371, 488, 858, 882
TscAI CASTG 3 cut(s) 430, 526, 655
TseFI GTSAC 2 cut(s) 157, 517
TseI GCWGC 1 cut(s) 49
Tsp45I GTSAC 2 cut(s) 157, 517
TspDTI ATGAA 2 cut(s) 42, 228
TspGWI ACGGA 1 cut(s) 353
TspRI CASTG 3 cut(s) 430, 526, 655
Van91I CCANNNNNTGG 1 cut(s) 317
VpaK11BI GGWCC 1 cut(s) 308
XagI CCTNNNNNAGG 1 cut(s) 169
XapI RAATTY 3 cut(s) 149, 245, 713
XbaI TCTAGA 1 cut(s) 781
XceI RCATGY 1 cut(s) 264
XmiI GTMKAC 1 cut(s) 381
XmnI GAANNNNTTC 1 cut(s) 354
XspI CTAG 4 cut(s) 125, 587, 639, 782
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.