FvH4_6g16850

Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Reverse (-)
10748933 .. 10749261
329 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g16850.t1

Sequence Viewer

Length: 237 bp
ATGGTTAAATCAAAGCAAGCACCTCTTCAGTTCTTTGCTTTCACTCTCTTTCTTTTGTCCTGGCAATCCATCAAACCCGTCAGAAGCCAAGGAGCGGAAGAAATAGGGTATGATTATAATCAAGGGAGCCTTAAGGGACCAGAACACTGGGGAGAGCTCAAGGAAGAATGGAAGGCATGCAAAGATGGAGATTTACAATCGCCAATAGATTTGTTGGATTCAAATGCTAGAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.9

Weight (kDa)

5.73

Isoelectric Point (pI)

60.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 117
AccBSI CCGCTC 1 cut(s) 95
AciI CCGC 1 cut(s) 95
AcuI CTGAAG 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 94
AflII CTTAAG 1 cut(s) 131
AgsI TTSAA 1 cut(s) 222
AjnI CCWGG 1 cut(s) 59
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
Alw21I GWGCWC 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 137
AvaII GGWCC 1 cut(s) 137
BanII GRGCYC 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 159
BccI CCATC 2 cut(s) 77, 179
BciT130I CCWGG 1 cut(s) 61
BfaI CTAG 1 cut(s) 228
BfrI CTTAAG 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 61
Bme18I GGWCC 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 137
BmiI GGNNCC 2 cut(s) 128, 138
BmrFI CCNGG 1 cut(s) 61
BmrI ACTGGG 1 cut(s) 157
BmuI ACTGGG 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 143
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 88
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 152
Bse8I GATNNNNATC 1 cut(s) 117
BseBI CCWGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 88
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 152
BsiHKAI GWGCWC 1 cut(s) 159
BslFI GGGAC 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 94
BsmFI GGGAC 1 cut(s) 150
Bsp1286I GDGCHC 1 cut(s) 159
BspACI CCGC 1 cut(s) 95
BspLI GGNNCC 2 cut(s) 128, 138
BspTI CTTAAG 1 cut(s) 131
BsrBI CCGCTC 1 cut(s) 95
BsrI ACTGG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 61
Bst6I CTCTTC 1 cut(s) 30
BstAFI CTTAAG 1 cut(s) 131
BstC8I GCNNGC 2 cut(s) 18, 178
BstNI CCWGG 1 cut(s) 61
BstNSI RCATGY 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 59
BstXI CCANNNNNNTGG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 145
Cac8I GCNNGC 2 cut(s) 18, 178
Cfr13I GGNCC 1 cut(s) 137
CviAII CATG 1 cut(s) 177
CviJI RGCY 3 cut(s) 87, 129, 157
CviKI_1 RGCY 3 cut(s) 87, 129, 157
Eam1104I CTCTTC 1 cut(s) 30
EarI CTCTTC 1 cut(s) 30
Ecl136II GAGCTC 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 137
Eco53kI GAGCTC 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 11
EcoICRI GAGCTC 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 59
EcoT14I CCWWGG 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 1 cut(s) 180
FaiI YATR 3 cut(s) 111, 117, 178
FalI AAGNNNNNCTT 4 cut(s) 9, 41, 114, 146
FaqI GGGAC 1 cut(s) 150
FatI CATG 1 cut(s) 176
FriOI GRGCYC 1 cut(s) 159
FspBI CTAG 1 cut(s) 228
Hin1II CATG 1 cut(s) 180
HinfI GANTC 1 cut(s) 218
Hpy188I TCNGA 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 166
HpyCH4V TGCA 1 cut(s) 180
Hsp92II CATG 1 cut(s) 180
LmnI GCTCC 2 cut(s) 92, 126
LpnPI CCDG 4 cut(s) 46, 73, 133, 153
MaeI CTAG 1 cut(s) 228
MbiI CCGCTC 1 cut(s) 95
MboII GAAGA 3 cut(s) 17, 110, 176
MhlI GDGCHC 1 cut(s) 159
MmeI TCCRAC 1 cut(s) 195
MnlI CCTC 1 cut(s) 33
MseI TTAA 2 cut(s) 6, 132
MspCI CTTAAG 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 61
MvaI CCWGG 1 cut(s) 61
NlaIII CATG 1 cut(s) 180
NlaIV GGNNCC 2 cut(s) 128, 138
NspI RCATGY 1 cut(s) 180
PaeI GCATGC 1 cut(s) 180
PfeI GAWTC 1 cut(s) 218
PsiI TTATAA 1 cut(s) 117
Psp124BI GAGCTC 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 59
PspGI CCWGG 1 cut(s) 59
PspN4I GGNNCC 2 cut(s) 128, 138
PspPI GGNCC 1 cut(s) 137
SacI GAGCTC 1 cut(s) 159
SaqAI TTAA 2 cut(s) 6, 132
Sau96I GGNCC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 61
SduI GDGCHC 1 cut(s) 159
SetI ASST 2 cut(s) 25, 159
SinI GGWCC 1 cut(s) 137
SmlI CTYRAG 2 cut(s) 131, 158
SmoI CTYRAG 2 cut(s) 131, 158
SphI GCATGC 1 cut(s) 180
SsiI CCGC 1 cut(s) 95
SspMI CTAG 1 cut(s) 228
SstI GAGCTC 1 cut(s) 159
StyD4I CCNGG 1 cut(s) 59
StyI CCWWGG 1 cut(s) 88
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 2 cut(s) 6, 132
Tru9I TTAA 2 cut(s) 6, 132
TscAI CASTG 1 cut(s) 152
TspRI CASTG 1 cut(s) 152
Vha464I CTTAAG 1 cut(s) 131
VpaK11BI GGWCC 1 cut(s) 137
XceI RCATGY 1 cut(s) 180
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.