Rmu_sc0000867.1_g000003

Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000867.1
Physical Location & Seq
Forward (+)
14013 .. 14418
406 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000867.1_g000003.1.cds

Sequence Viewer

Length: 327 bp
atgaaaactcctcttcagttctttgctttcactctttttcttctgtactggcaaccaatcaaacccatcagagctggccatggtgtggaagaaatagggtataattataggaaagggagcaagaagggaccagagcactggggagaccttaagaaagaatggaaggcatgcaaagatggaaaattgcaatcgccaatagatttgtcggataagcacgctagaaaagcaatctcaagagtatatgatcttaaaatgagctataagccttcaaatgcaactatgaagaatgaaggtcatgctattgcggtatggaagcttagtgcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.42

Weight (kDa)

9.8

Isoelectric Point (pI)

31.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 85
AciI CCGC 1 cut(s) 305
AcoI YGGCCR 1 cut(s) 76
AfaI GTAC 1 cut(s) 47
AfiI CCNNNNNNNGG 1 cut(s) 85
AflII CTTAAG 1 cut(s) 149
AgsI TTSAA 1 cut(s) 270
AluBI AGCT 3 cut(s) 74, 258, 316
AluI AGCT 3 cut(s) 74, 258, 316
Alw21I GWGCWC 1 cut(s) 138
Alw26I GTCTC 1 cut(s) 138
AoxI GGCC 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
BalI TGGCCA 1 cut(s) 78
Bbv12I GWGCWC 1 cut(s) 138
BccI CCATC 2 cut(s) 74, 170
BcoDI GTCTC 1 cut(s) 138
BfaI CTAG 2 cut(s) 219, 325
BfrI CTTAAG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 129
BmrI ACTGGG 1 cut(s) 148
BmuI ACTGGG 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 217
BsaI GGTCTC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse1I ACTGG 2 cut(s) 53, 143
BseDI CCNNGG 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 85
BseNI ACTGG 2 cut(s) 53, 143
BshFI GGCC 1 cut(s) 78
BsiHKAI GWGCWC 1 cut(s) 138
BslFI GGGAC 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 85
BsmAI GTCTC 1 cut(s) 138
BsmFI GGGAC 1 cut(s) 141
BsnI GGCC 1 cut(s) 78
Bso31I GGTCTC 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 244
Bsp19I CCATGG 1 cut(s) 79
BspACI CCGC 1 cut(s) 305
BspANI GGCC 1 cut(s) 78
BspLI GGNNCC 1 cut(s) 129
BspTI CTTAAG 1 cut(s) 149
BspTNI GGTCTC 1 cut(s) 138
BsrI ACTGG 2 cut(s) 53, 143
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 244
BssT1I CCWWGG 1 cut(s) 79
Bst6I CTCTTC 1 cut(s) 18
BstAFI CTTAAG 1 cut(s) 149
BstC8I GCNNGC 3 cut(s) 76, 169, 216
BstDEI CTNAG 1 cut(s) 317
BstDSI CCRYGG 1 cut(s) 79
BstKTI GATC 1 cut(s) 247
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 1 cut(s) 244
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstNSI RCATGY 1 cut(s) 171
BstXI CCANNNNNNTGG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 78
BtgI CCRYGG 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 136
Cac8I GCNNGC 3 cut(s) 76, 169, 216
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 46
CviAII CATG 3 cut(s) 80, 168, 296
CviJI RGCY 5 cut(s) 74, 78, 258, 265, 316
CviKI_1 RGCY 5 cut(s) 74, 78, 258, 265, 316
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 317
DpnI GATC 1 cut(s) 246
DpnII GATC 1 cut(s) 244
EaeI YGGCCR 1 cut(s) 76
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 79
Eco31I GGTCTC 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 3 cut(s) 83, 171, 299
FaqI GGGAC 1 cut(s) 141
FatI CATG 3 cut(s) 79, 167, 295
FspBI CTAG 2 cut(s) 219, 325
HaeIII GGCC 1 cut(s) 78
Hin1II CATG 3 cut(s) 83, 171, 299
HindIII AAGCTT 1 cut(s) 314
Hpy188I TCNGA 2 cut(s) 71, 208
Hpy188III TCNNGA 1 cut(s) 234
HpyAV CCTTC 4 cut(s) 118, 157, 276, 284
HpyCH4V TGCA 3 cut(s) 171, 187, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 1 cut(s) 317
Hsp92II CATG 3 cut(s) 83, 171, 299
Kzo9I GATC 1 cut(s) 244
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 4 cut(s) 34, 60, 124, 144
MaeI CTAG 2 cut(s) 219, 325
MalI GATC 1 cut(s) 246
MboI GATC 1 cut(s) 244
MboII GAAGA 4 cut(s) 5, 32, 101, 295
MhlI GDGCHC 1 cut(s) 138
MlsI TGGCCA 1 cut(s) 78
MluCI AATT 2 cut(s) 103, 182
MluNI TGGCCA 1 cut(s) 78
MmeI TCCRAC 1 cut(s) 186
MnlI CCTC 1 cut(s) 21
Mox20I TGGCCA 1 cut(s) 78
MscI TGGCCA 1 cut(s) 78
MseI TTAA 2 cut(s) 150, 249
Msp20I TGGCCA 1 cut(s) 78
MspCI CTTAAG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 224
NcoI CCATGG 1 cut(s) 79
NdeII GATC 1 cut(s) 244
NlaIII CATG 3 cut(s) 83, 171, 299
NlaIV GGNNCC 1 cut(s) 129
NspI RCATGY 1 cut(s) 171
PaeI GCATGC 1 cut(s) 171
PflMI CCANNNNNTGG 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 129
PspPI GGNCC 1 cut(s) 128
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 2 cut(s) 150, 249
Sau3AI GATC 1 cut(s) 244
Sau96I GGNCC 1 cut(s) 128
SduI GDGCHC 1 cut(s) 138
SetI ASST 5 cut(s) 76, 150, 260, 295, 318
SinI GGWCC 1 cut(s) 128
SmlI CTYRAG 2 cut(s) 149, 232
SmoI CTYRAG 2 cut(s) 149, 232
SphI GCATGC 1 cut(s) 171
Sse9I AATT 2 cut(s) 103, 182
SsiI CCGC 1 cut(s) 305
SspMI CTAG 2 cut(s) 219, 325
StyI CCWWGG 1 cut(s) 79
TasI AATT 2 cut(s) 103, 182
TatI WGTACW 1 cut(s) 45
Tru1I TTAA 2 cut(s) 150, 249
Tru9I TTAA 2 cut(s) 150, 249
TscAI CASTG 1 cut(s) 143
TspDTI ATGAA 3 cut(s) 17, 296, 303
TspRI CASTG 1 cut(s) 143
Van91I CCANNNNNTGG 1 cut(s) 85
Vha464I CTTAAG 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 128
XceI RCATGY 1 cut(s) 171
XspI CTAG 2 cut(s) 219, 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.