MD05G1267700.v1.1

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
40291770 .. 40292006
237 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1267700.v1.1.491

Sequence Viewer

Length: 237 bp
ATGGAGATCTCACACATAAAACTCGTTCCCTTACTATTTTTCTTCCTTCTAAACTCAGTTTGTTCTACAACTTCAAACTCGATTTCGGAAAGCTTTGTTCAATGCTTTTCCTCCCGCATACATTCTAACTCAACAAGCAAAATCATCCTCACTGAAAGCTCTTCGGATTATACCCTAGTGTTGCAATCTTCCATAAAGAATCTCCGATTCTTGAACACATCAACTCCGAAACCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.72

Weight (kDa)

8.77

Isoelectric Point (pI)

50.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 115
AgsI TTSAA 3 cut(s) 75, 101, 214
AluBI AGCT 2 cut(s) 93, 159
AluI AGCT 2 cut(s) 93, 159
BfaI CTAG 1 cut(s) 176
BglII AGATCT 1 cut(s) 6
BsaXI ACNNNNNCTCC 1 cut(s) 208
BseGI GGATG 1 cut(s) 144
BseMII CTCAG 1 cut(s) 69
Bsp143I GATC 1 cut(s) 6
BspACI CCGC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 68
BspQI GCTCTTC 1 cut(s) 166
BssMI GATC 1 cut(s) 6
Bst6I CTCTTC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 55
BstF5I GGATG 1 cut(s) 144
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BtsCI GGATG 1 cut(s) 144
BtsIMutI CAGTG 1 cut(s) 150
CviJI RGCY 2 cut(s) 93, 159
CviKI_1 RGCY 2 cut(s) 93, 159
DdeI CTNAG 1 cut(s) 55
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
FaiI YATR 5 cut(s) 17, 119, 171, 194, 235
FauI CCCGC 1 cut(s) 122
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 176
HindIII AAGCTT 1 cut(s) 91
HinfI GANTC 2 cut(s) 199, 207
Hpy188I TCNGA 4 cut(s) 88, 166, 206, 228
Hpy188III TCNNGA 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 56
HpyCH4V TGCA 1 cut(s) 184
HpyF3I CTNAG 1 cut(s) 55
Kzo9I GATC 1 cut(s) 6
LguI GCTCTTC 1 cut(s) 166
MaeI CTAG 1 cut(s) 176
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 3 cut(s) 34, 153, 180
MflI RGATCY 1 cut(s) 6
MnlI CCTC 2 cut(s) 121, 158
NdeII GATC 1 cut(s) 6
PciSI GCTCTTC 1 cut(s) 166
PfeI GAWTC 2 cut(s) 199, 207
PsuI RGATCY 1 cut(s) 6
SapI GCTCTTC 1 cut(s) 166
Sau3AI GATC 1 cut(s) 6
SetI ASST 2 cut(s) 95, 161
SgeI CNNG 6 cut(s) 35, 91, 126, 147, 188, 223
SsiI CCGC 1 cut(s) 115
SspMI CTAG 1 cut(s) 176
TaqI TCGA 1 cut(s) 80
TfiI GAWTC 2 cut(s) 199, 207
TscAI CASTG 1 cut(s) 157
TspRI CASTG 1 cut(s) 157
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.