Prupe.4G097200_v2.0.a1

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Reverse (-)
4880834 .. 4881418
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G097200.1

Sequence Viewer

Length: 585 bp
ATGAGTTGGATCCAGTCTGTGATGTACTTTGCTGGCTTCCCAATAAGCGAATATTTGGAAGTTTTGCTGAAAAGGACTCAGCCATCTAGGAGCTTCTTCAAAGCAAAATCGGACAATGTGACGCAACCCATTTCACAAGCTGGCTTGGAAGGTTTGTGGCAAAGACTACTTGAAGTAGAGACATCCCAGTTGATATTGACACCTTACGGTGGAAGAATGAGTGAGATATCTGATTCAGAAACTCCTTTCCCACATAGAAATGGAAGTATATTTGCAATCCAGTATTTGGTCACTTGGGATGATGACAAGGAAACTGAGAAACATATTAGCTGGATGAGAAGGGTGTATGCCTACATGGCATCACATGTTTCAAAGTCCCCAAGAGCTGTCTATTTGAACTATAGGGATCTAGACTTGGGGAGGAACCATGATGCTAATACAAGCTATGCACAAGCAAGCATTTGGGGTTTGAAGTATTTCAAGAGTAACTTTAGGAGACTTGTTCATGTAAAGACCTTAGTTGATCCTGGTAACTTCCTTAGAAATGAGCAAAGCATCCCTGTTTTACCATCTGGGCAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

195

Amino Acids

22.43

Weight (kDa)

9.24

Isoelectric Point (pI)

52.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 286
AclWI GGATC 4 cut(s) 4, 17, 414, 518
AfaI GTAC 1 cut(s) 26
AfiI CCNNNNNNNGG 2 cut(s) 209, 286
AflIII ACRYGT 1 cut(s) 364
AgsI TTSAA 6 cut(s) 100, 173, 372, 397, 472, 481
AjnI CCWGG 1 cut(s) 526
AluBI AGCT 5 cut(s) 93, 140, 330, 386, 444
AluI AGCT 5 cut(s) 93, 140, 330, 386, 444
Alw26I GTCTC 2 cut(s) 173, 490
AlwI GGATC 4 cut(s) 4, 17, 414, 518
Asp700I GAANNNNTTC 1 cut(s) 476
BamHI GGATCC 1 cut(s) 9
BccI CCATC 2 cut(s) 91, 577
BciT130I CCWGG 1 cut(s) 528
BcoDI GTCTC 2 cut(s) 173, 490
BfaI CTAG 2 cut(s) 87, 410
BfmI CTRYAG 1 cut(s) 400
BglI GCCNNNNNGGC 1 cut(s) 356
Bme1390I CCNGG 1 cut(s) 528
BmiI GGNNCC 2 cut(s) 11, 425
BmrFI CCNGG 1 cut(s) 528
BmrI ACTGGG 1 cut(s) 181
BmsI GCATC 3 cut(s) 368, 421, 564
BmuI ACTGGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 2 cut(s) 209, 286
Bse1I ACTGG 3 cut(s) 13, 187, 280
BseBI CCWGG 1 cut(s) 528
BseGI GGATG 4 cut(s) 182, 304, 339, 555
BseLI CCNNNNNNNGG 2 cut(s) 209, 286
BseMII CTCAG 2 cut(s) 92, 306
BseNI ACTGG 3 cut(s) 13, 187, 280
BslFI GGGAC 1 cut(s) 361
BslI CCNNNNNNNGG 2 cut(s) 209, 286
BsmAI GTCTC 2 cut(s) 173, 490
BsmFI GGGAC 1 cut(s) 361
Bsp143I GATC 3 cut(s) 9, 406, 523
BspCNI CTCAG 2 cut(s) 91, 307
BspLI GGNNCC 2 cut(s) 11, 425
BspPI GGATC 4 cut(s) 4, 17, 414, 518
BsrI ACTGG 3 cut(s) 13, 187, 280
BssMI GATC 3 cut(s) 9, 406, 523
Bst2UI CCWGG 1 cut(s) 528
Bst4CI ACNGT 1 cut(s) 209
BstC8I GCNNGC 3 cut(s) 34, 142, 457
BstDEI CTNAG 4 cut(s) 78, 315, 517, 539
BstF5I GGATG 4 cut(s) 182, 304, 339, 555
BstKTI GATC 3 cut(s) 12, 409, 526
BstMAI GTCTC 2 cut(s) 173, 490
BstMBI GATC 3 cut(s) 9, 406, 523
BstMWI GCNNNNNNNGC 1 cut(s) 356
BstNI CCWGG 1 cut(s) 528
BstNSI RCATGY 1 cut(s) 368
BstSCI CCNGG 1 cut(s) 526
BstSFI CTRYAG 1 cut(s) 400
BstX2I RGATCY 2 cut(s) 9, 406
BstYI RGATCY 2 cut(s) 9, 406
BtsCI GGATG 4 cut(s) 182, 304, 339, 555
Cac8I GCNNGC 3 cut(s) 34, 142, 457
CseI GACGC 1 cut(s) 130
Csp6I GTAC 1 cut(s) 25
CviAII CATG 4 cut(s) 355, 365, 428, 506
CviJI RGCY 8 cut(s) 36, 82, 93, 140, 144, 330, 386, 444
CviKI_1 RGCY 8 cut(s) 36, 82, 93, 140, 144, 330, 386, 444
CviQI GTAC 1 cut(s) 25
DdeI CTNAG 4 cut(s) 78, 315, 517, 539
DpnI GATC 3 cut(s) 11, 408, 525
DpnII GATC 3 cut(s) 9, 406, 523
Eco32I GATATC 1 cut(s) 228
EcoRII CCWGG 1 cut(s) 526
EcoRV GATATC 1 cut(s) 228
FaeI CATG 4 cut(s) 358, 368, 431, 509
FalI AAGNNNNNCTT 2 cut(s) 473, 505
FaqI GGGAC 1 cut(s) 361
FatI CATG 4 cut(s) 354, 364, 427, 505
FokI GGATG 4 cut(s) 169, 311, 346, 542
FspBI CTAG 2 cut(s) 87, 410
HgaI GACGC 1 cut(s) 130
Hin1II CATG 4 cut(s) 358, 368, 431, 509
HinfI GANTC 2 cut(s) 76, 233
Hpy188I TCNGA 3 cut(s) 112, 232, 238
Hpy188III TCNNGA 2 cut(s) 410, 481
HpyAV CCTTC 2 cut(s) 143, 333
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4V TGCA 2 cut(s) 275, 449
HpyF10VI GCNNNNNNNGC 1 cut(s) 356
HpyF3I CTNAG 4 cut(s) 78, 315, 517, 539
Hsp92II CATG 4 cut(s) 358, 368, 431, 509
Kzo9I GATC 3 cut(s) 9, 406, 523
LmnI GCTCC 1 cut(s) 90
LweI GCATC 3 cut(s) 368, 421, 564
MaeI CTAG 2 cut(s) 87, 410
MaeIII GTNAC 4 cut(s) 118, 289, 485, 530
MalI GATC 3 cut(s) 11, 408, 525
MboI GATC 3 cut(s) 9, 406, 523
MboII GAAGA 2 cut(s) 88, 225
MflI RGATCY 2 cut(s) 9, 406
MlyI GAGTC 1 cut(s) 70
MnlI CCTC 1 cut(s) 414
MroXI GAANNNNTTC 1 cut(s) 476
MslI CAYNNNNRTG 1 cut(s) 258
MspR9I CCNGG 1 cut(s) 528
MvaI CCWGG 1 cut(s) 528
MwoI GCNNNNNNNGC 1 cut(s) 356
NdeII GATC 3 cut(s) 9, 406, 523
NlaIII CATG 4 cut(s) 358, 368, 431, 509
NlaIV GGNNCC 2 cut(s) 11, 425
NmuCI GTSAC 2 cut(s) 118, 289
NspI RCATGY 1 cut(s) 368
PciI ACATGT 1 cut(s) 364
PdmI GAANNNNTTC 1 cut(s) 476
PfeI GAWTC 1 cut(s) 233
PflMI CCANNNNNTGG 1 cut(s) 286
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
PscI ACATGT 1 cut(s) 364
Psp6I CCWGG 1 cut(s) 526
PspGI CCWGG 1 cut(s) 526
PspN4I GGNNCC 2 cut(s) 11, 425
PsuI RGATCY 2 cut(s) 9, 406
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
RseI CAYNNNNRTG 1 cut(s) 258
Sau3AI GATC 3 cut(s) 9, 406, 523
SchI GAGTC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 528
SetI ASST 8 cut(s) 95, 142, 154, 205, 332, 388, 446, 518
SfaNI GCATC 3 cut(s) 368, 421, 564
SfcI CTRYAG 1 cut(s) 400
SmiMI CAYNNNNRTG 1 cut(s) 258
SspI AATATT 1 cut(s) 53
SspMI CTAG 2 cut(s) 87, 410
StyD4I CCNGG 1 cut(s) 526
TaaI ACNGT 1 cut(s) 209
TatI WGTACW 1 cut(s) 24
TfiI GAWTC 1 cut(s) 233
TseFI GTSAC 2 cut(s) 118, 289
Tsp45I GTSAC 2 cut(s) 118, 289
TspDTI ATGAA 1 cut(s) 494
Van91I CCANNNNNTGG 1 cut(s) 286
XbaI TCTAGA 1 cut(s) 409
XceI RCATGY 1 cut(s) 368
XmnI GAANNNNTTC 1 cut(s) 476
XspI CTAG 2 cut(s) 87, 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.