Prupe.4G097300_v2.0.a1

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0000925
Physical Location & Seq
Reverse (-)
4881637 .. 4882329
693 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G097300.1

Sequence Viewer

Length: 693 bp
ATGGGGATCTTCGACGTAAAACTAGTTCCACTACTTATCATCCTTTTCAACTCAGTTTGGTCCACAAGTTCAAATTCAATTTCTGAAAGCTTACTTCAATGTCTTTCCACTCACCTAAAGCATTCTAACTCAAGTAAGGAAATAATCTTAACCAGAAACAGTTCTGCTTATTCCTCAATCTTGCAATCTTCCATACAGAACCTCAGATTCTTGAACAATTCAACGCCAAAACCCAAAGTTATCGTTACTCCTTTCCATGAATCTCATGTTCAAGCAGCAGTTATTTGCTCCAAGAAACATGGCATACAAAAAAGATTCCAAAGTGGGGGCCATGACTACGAGGGCCTATCTTATGTATCATATGCTCCTTTCATCATCATTGAACTTTTCAATCTTCAGACCATCCATATTGACGTAAAGAATGAGAGTGCATGGGTCGAATCCGGTGCTACACTTGGTGAATTGTATTACTTAATAGCACAAAAAAGTAATGTACATGAATTTCCAGCAGGGTCTTGTCCCACAATGGGTGTGGGAGGACATATTAGTGGAGGTGGATTTGGTACCATATTCAGGAAATATGGTCTGGCAGTTGACAATGTCATTGATGCTAGGATTGTTGATGTCAATGGCAGAATTCTCAGCAGAAAGTCCAAGGGAGAAGAACTCTTATGGGCTATCAGAGGAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

231

Amino Acids

25.22

Weight (kDa)

8.94

Isoelectric Point (pI)

45.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 563
AccB1I GGYRCC 1 cut(s) 563
AclWI GGATC 1 cut(s) 14
AcsI RAATTY 3 cut(s) 73, 500, 636
AcuI CTGAAG 1 cut(s) 380
AdeI CACNNNGTG 1 cut(s) 458
AfaI GTAC 2 cut(s) 495, 565
AfiI CCNNNNNNNGG 3 cut(s) 325, 527, 573
AgsI TTSAA 9 cut(s) 49, 72, 78, 98, 214, 222, 272, 383, 391
AhlI ACTAGT 1 cut(s) 22
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
AlwI GGATC 1 cut(s) 14
AoxI GGCC 2 cut(s) 328, 343
ApeKI GCWGC 1 cut(s) 275
ApoI RAATTY 3 cut(s) 73, 500, 636
Asp700I GAANNNNTTC 1 cut(s) 160
Asp718I GGTACC 1 cut(s) 563
AspS9I GGNCC 3 cut(s) 60, 328, 343
AsuHPI GGTGA 2 cut(s) 104, 470
AvaII GGWCC 1 cut(s) 60
BanI GGYRCC 1 cut(s) 563
BbvI GCAGC 1 cut(s) 287
BccI CCATC 1 cut(s) 410
BcgI CGANNNNNNTGC 2 cut(s) 428, 462
BcuI ACTAGT 1 cut(s) 22
BfaI CTAG 2 cut(s) 23, 612
BisI GCNGC 1 cut(s) 276
BlsI GCNGC 1 cut(s) 277
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 3 cut(s) 60, 328, 343
BmiI GGNNCC 2 cut(s) 329, 565
BmsI GCATC 1 cut(s) 598
BplI GAGNNNNNCTC 2 cut(s) 651, 683
BpuEI CTTGAG 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 654
BsaWI WCCGGW 1 cut(s) 443
Bsc4I CCNNNNNNNGG 3 cut(s) 325, 527, 573
BseDI CCNNGG 1 cut(s) 654
BseGI GGATG 2 cut(s) 39, 402
BseLI CCNNNNNNNGG 3 cut(s) 325, 527, 573
BseMII CTCAG 3 cut(s) 66, 217, 655
BseXI GCAGC 1 cut(s) 287
BshFI GGCC 2 cut(s) 330, 345
BshNI GGYRCC 1 cut(s) 563
BsiSI CCGG 1 cut(s) 444
BslFI GGGAC 1 cut(s) 504
BslI CCNNNNNNNGG 3 cut(s) 325, 527, 573
BsmFI GGGAC 1 cut(s) 504
BsmI GAATGC 1 cut(s) 121
BsnI GGCC 2 cut(s) 330, 345
Bsp1407I TGTACA 1 cut(s) 493
Bsp143I GATC 1 cut(s) 6
BspANI GGCC 2 cut(s) 330, 345
BspCNI CTCAG 3 cut(s) 65, 216, 654
BspLI GGNNCC 2 cut(s) 329, 565
BspPI GGATC 1 cut(s) 14
BspT107I GGYRCC 1 cut(s) 563
BsrGI TGTACA 1 cut(s) 493
BssECI CCNNGG 1 cut(s) 654
BssMI GATC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 654
Bst4CI ACNGT 1 cut(s) 161
BstAUI TGTACA 1 cut(s) 493
BstDEI CTNAG 3 cut(s) 52, 203, 641
BstF5I GGATG 2 cut(s) 39, 402
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 287
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BsuRI GGCC 2 cut(s) 330, 345
BtsCI GGATG 2 cut(s) 39, 402
Cfr13I GGNCC 3 cut(s) 60, 328, 343
Csp6I GTAC 2 cut(s) 494, 564
CspCI CAANNNNNGTGG 2 cut(s) 513, 548
CviAII CATG 6 cut(s) 257, 266, 299, 332, 432, 497
CviJI RGCY 4 cut(s) 90, 330, 345, 677
CviKI_1 RGCY 4 cut(s) 90, 330, 345, 677
CviQI GTAC 2 cut(s) 494, 564
DdeI CTNAG 3 cut(s) 52, 203, 641
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
DraIII CACNNNGTG 1 cut(s) 458
Eco130I CCWWGG 1 cut(s) 654
Eco47I GGWCC 1 cut(s) 60
Eco57I CTGAAG 1 cut(s) 380
EcoO109I RGGNCCY 1 cut(s) 343
EcoRI GAATTC 1 cut(s) 636
EcoT14I CCWWGG 1 cut(s) 654
ErhI CCWWGG 1 cut(s) 654
FaeI CATG 6 cut(s) 260, 269, 302, 335, 435, 500
FaqI GGGAC 1 cut(s) 504
FatI CATG 6 cut(s) 256, 265, 298, 331, 431, 496
FauNDI CATATG 1 cut(s) 361
Fnu4HI GCNGC 1 cut(s) 276
FokI GGATG 2 cut(s) 26, 389
Fsp4HI GCNGC 1 cut(s) 276
FspBI CTAG 2 cut(s) 23, 612
GluI GCNGC 1 cut(s) 276
HaeIII GGCC 2 cut(s) 330, 345
HapII CCGG 1 cut(s) 444
Hin1II CATG 6 cut(s) 260, 269, 302, 335, 435, 500
HincII GTYRAC 1 cut(s) 595
HindII GTYRAC 1 cut(s) 595
HindIII AAGCTT 1 cut(s) 88
HinfI GANTC 4 cut(s) 207, 260, 315, 440
HpaII CCGG 1 cut(s) 444
HphI GGTGA 2 cut(s) 104, 470
Hpy166II GTNNAC 2 cut(s) 63, 595
Hpy188I TCNGA 4 cut(s) 85, 206, 399, 683
Hpy188III TCNNGA 2 cut(s) 211, 574
Hpy8I GTNNAC 2 cut(s) 63, 595
Hpy99I CGWCG 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4IV ACGT 2 cut(s) 15, 414
HpyCH4V TGCA 2 cut(s) 184, 431
HpyF3I CTNAG 3 cut(s) 52, 203, 641
HpySE526I ACGT 2 cut(s) 15, 414
Hsp92II CATG 6 cut(s) 260, 269, 302, 335, 435, 500
KpnI GGTACC 1 cut(s) 567
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 2 cut(s) 293, 370
LpnPI CCDG 6 cut(s) 166, 457, 495, 519, 559, 572
Lsp1109I GCAGC 1 cut(s) 287
LweI GCATC 1 cut(s) 598
MaeI CTAG 2 cut(s) 23, 612
MaeII ACGT 2 cut(s) 15, 414
MaeIII GTNAC 1 cut(s) 244
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 3 cut(s) 180, 386, 674
MflI RGATCY 1 cut(s) 6
MluCI AATT 6 cut(s) 73, 78, 217, 461, 500, 636
MnlI CCTC 7 cut(s) 184, 212, 334, 530, 545, 677, 680
MroXI GAANNNNTTC 1 cut(s) 160
MseI TTAA 2 cut(s) 149, 473
MslI CAYNNNNRTG 1 cut(s) 546
MspI CCGG 1 cut(s) 444
Mva1269I GAATGC 1 cut(s) 121
NdeI CATATG 1 cut(s) 361
NdeII GATC 1 cut(s) 6
NlaIII CATG 6 cut(s) 260, 269, 302, 335, 435, 500
NlaIV GGNNCC 2 cut(s) 329, 565
PctI GAATGC 1 cut(s) 121
PdmI GAANNNNTTC 1 cut(s) 160
PfeI GAWTC 4 cut(s) 207, 260, 315, 440
PflFI GACNNNGTC 1 cut(s) 599
PkrI GCNGC 1 cut(s) 277
PspN4I GGNNCC 2 cut(s) 329, 565
PspPI GGNCC 3 cut(s) 60, 328, 343
PsrI GAACNNNNNNTAC 2 cut(s) 9, 41
PsuI RGATCY 1 cut(s) 6
PsyI GACNNNGTC 1 cut(s) 599
RsaI GTAC 2 cut(s) 495, 565
RsaNI GTAC 2 cut(s) 494, 564
RseI CAYNNNNRTG 1 cut(s) 546
SaqAI TTAA 2 cut(s) 149, 473
SatI GCNGC 1 cut(s) 276
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 3 cut(s) 60, 328, 343
SetI ASST 6 cut(s) 18, 92, 117, 204, 417, 556
SfaNI GCATC 1 cut(s) 598
SinI GGWCC 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 546
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
SpeI ACTAGT 1 cut(s) 22
Sse9I AATT 6 cut(s) 73, 78, 217, 461, 500, 636
SspMI CTAG 2 cut(s) 23, 612
StyI CCWWGG 1 cut(s) 654
TaaI ACNGT 1 cut(s) 161
TaiI ACGT 2 cut(s) 18, 417
TaqI TCGA 2 cut(s) 12, 438
TasI AATT 6 cut(s) 73, 78, 217, 461, 500, 636
TatI WGTACW 1 cut(s) 493
TfiI GAWTC 4 cut(s) 207, 260, 315, 440
Tru1I TTAA 2 cut(s) 149, 473
Tru9I TTAA 2 cut(s) 149, 473
TseI GCWGC 1 cut(s) 275
TspDTI ATGAA 3 cut(s) 273, 361, 513
Tth111I GACNNNGTC 1 cut(s) 599
VpaK11BI GGWCC 1 cut(s) 60
XapI RAATTY 3 cut(s) 73, 500, 636
XcmI CCANNNNNNNNNTGG 1 cut(s) 529
XmnI GAANNNNTTC 1 cut(s) 160
XspI CTAG 2 cut(s) 23, 612
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.