MD11G1128800.v1.1

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
11732980 .. 11736218
3239 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1128800.v1.1.491

Sequence Viewer

Length: 1599 bp
ATGCCTAACATAATTGTCTACAACACGATCATCGACAGTCTTTGCAAAGATGCTCTAGTTGTTGATTCACTGAACCTCTTTTTAGAAATGACGAGTAAGGCCATTGCTCCCAATGTCATTACCTATACCTCTTTGATTCACGGAGTTTGCAAAGTAAGGAAGTGGAAAGAAGCTACAAAATTGTTGAATGAAATGGTGGAGAAACATATCAGTCCAGATGTGCACACCTTCAATGTCTTGGTTGATACATTTTGCAAAGAGAGGATGGTCCAGGAAGCAAGGAGCGTGGTTGAGATGATGATGCAAAGATATATCAAACCTAGTACAATCACGTACAATTCGCTTATGGATGGGTATTGTTTGCGGGGAGAAATGGACGAGGTAAAAGAGGTTTTTGAAGTAATGGCTATTATTGAGGAAAAGAAGTTGGATATTGGTATTGTAACTTATAATATTCTTATTGACGGTTTGTGCAGAGCTGAAAAAGTTGAATATGCATGGGATTTCTTTCGTTGTTTATCATCAAAAGGAATTCAACCTAATGGCAAGACATATACTATAATGATTCGTGGATTATGTAATGGGGGGCAAATATGTGAAACGGAAAACTTGCTCAGAGAAATGAAAAAGAAAGGCTGTTCTCCAGATGGTTGGACGTACAACACAATTATTCGAGGGTTTATCAATAACAATGAGACATCAACAGGAGTGAGGCTTATTCAAGAAATGGTGAAGAGGGATTTTTCTGCAGATGTATCAACTACGGAGTTGATTGTTAATTTATTGTCTAAAGATAGGCATTACCATAATACCATTAGCACCAGAGGTATGCTGCCTCGCCTTCTTCAATCTTCTTATGTCGTTGTTTTCTTCAACAATTACTTGGGTTTGTTTCACTCTCGAGCTTCTAAATTGACGGAATCAAGAAACACCCAACAACACCTGCGTGTGAAAATCACTAATGTTGAGGATGCTCTCAATGTGTTCGACGAAATGCTTCAAAGGCGTCCTCTGCCTTCTATTATCCCTTTCACTCAAGTGTTGGGTCAACTTGCCAAGTTGAAAAATTACTCAACAATCATCTCCTTGAACAACCAAATGGTTATGTCTAGAAATCGTCCAAATGCTTATACTCTAACCATTATCATTAATTGCTTTTGTCATCTCAACCAAATGGAGTTTAGTTTGTCAGTCTTAGGTATCTTATTCAAATTAGGTTTTGAGCCAAATGTCACAACCTACACCACTCTAATAAACGACTTTCTTCTTAAGAATAGAGAGGCTAAGGCAGCAACACTTTTCAACAAAATGATAGAGAGAGGTAATTGCAAGCCTGATGTGGTTACTTTCGGTACACTAGTAAAGGGCCTCTACTTGAAAGGTAACAATACTGCAGCAATCCAATTGCTTAAGAAGATGGAAGGAGCTTGCAAGCCTGATGTAGTTGTCTATAGCACAATCATGGACAGTCTTTGCAAGGATACTCTAGTTGTTGATGCACTAAACCTCTTCTCAGAAATGATGAGTAAGGGCATTGCTCCCGCCATCATTACCTATACCTCATGGATTTTGCAAAGTAGAGAATTGGAAAGAAGCTAA

Protein Analysis

533

Amino Acids

60.56

Weight (kDa)

8.68

Isoelectric Point (pI)

32.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 2 - 51 1.5e-14 PPR repeat family
PPR_1 PF12854 2 - 30 6.3e-06 PPR repeat
PPR_long PF17177 20 - 133 2.5e-10 Pentacotripeptide-repeat region of PRORP
PPR_3 PF13812 26 - 85 2e-13 Pentatricopeptide repeat domain
PPR_1 PF12854 35 - 66 1.1e-10 PPR repeat
PPR_2 PF13041 38 - 86 4.2e-17 PPR repeat family
MRP-S27 PF10037 38 - 103 6.8e-07 Mitochondrial 28S ribosomal protein S27
PPR PF01535 40 - 69 7.3e-07 PPR repeat
TPR_24 PF23276 60 - 171 3.3e-08 Fungal tetratrico peptide repeats
PPR_1 PF12854 68 - 100 2.5e-07 PPR repeat
PPR_2 PF13041 74 - 120 4.7e-11 PPR repeat family
PPR_1 PF12854 105 - 135 3.3e-08 PPR repeat
PPR PF01535 110 - 135 2.1e-06 PPR repeat
PPR_2 PF13041 147 - 194 1.8e-17 PPR repeat family
PPR_1 PF12854 147 - 171 7.4e-08 PPR repeat
PPR PF01535 148 - 178 5.4e-06 PPR repeat
PPR_3 PF13812 173 - 227 7.1e-09 Pentatricopeptide repeat domain
PPR_1 PF12854 176 - 209 5.3e-07 PPR repeat
PPR_2 PF13041 191 - 228 3.9e-09 PPR repeat family
PPR_2 PF13041 219 - 262 4.4e-06 PPR repeat family
PPR_2 PF13041 409 - 457 9.3e-10 PPR repeat family
PPR_3 PF13812 439 - 489 8.2e-06 Pentatricopeptide repeat domain
PPR_1 PF12854 442 - 474 1.3e-06 PPR repeat
PPR_2 PF13041 445 - 493 1.6e-08 PPR repeat family
PPR_1 PF12854 477 - 507 2.6e-09 PPR repeat
PPR_2 PF13041 479 - 521 2.4e-10 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 450
AarI CACCTGC 1 cut(s) 951
Acc36I ACCTGC 1 cut(s) 951
AccI GTMKAC 1 cut(s) 18
AciI CCGC 2 cut(s) 364, 1542
AcsI RAATTY 1 cut(s) 531
AcyI GRCGYC 1 cut(s) 1006
AfaI GTAC 4 cut(s) 325, 335, 659, 1354
AflII CTTAAG 2 cut(s) 1268, 1409
AhlI ACTAGT 1 cut(s) 1357
AjnI CCWGG 1 cut(s) 270
AleI CACNNNNGTG 2 cut(s) 945, 1037
AluBI AGCT 5 cut(s) 173, 479, 905, 1427, 1596
AluI AGCT 5 cut(s) 173, 479, 905, 1427, 1596
Alw21I GWGCWC 1 cut(s) 225
Alw26I GTCTC 1 cut(s) 689
Alw44I GTGCAC 1 cut(s) 221
Ama87I CYCGRG 1 cut(s) 900
AoxI GGCC 2 cut(s) 99, 1366
ApaLI GTGCAC 1 cut(s) 221
ApeKI GCWGC 3 cut(s) 832, 1289, 1394
ApoI RAATTY 1 cut(s) 531
AseI ATTAAT 1 cut(s) 1149
Asp700I GAANNNNTTC 1 cut(s) 996
AspS9I GGNCC 2 cut(s) 268, 1366
AsuHPI GGTGA 1 cut(s) 742
AvaI CYCGRG 1 cut(s) 900
AvaII GGWCC 1 cut(s) 268
BaeGI GKGCMC 1 cut(s) 225
BaeI ACNNNNGTAYC 4 cut(s) 1344, 1377, 1473, 1506
Bbv12I GWGCWC 1 cut(s) 225
BbvI GCAGC 3 cut(s) 819, 1301, 1406
BccI CCATC 5 cut(s) 259, 344, 641, 1411, 1553
BciT130I CCWGG 1 cut(s) 272
BciVI GTATCC 1 cut(s) 1474
BcoDI GTCTC 1 cut(s) 689
BcuI ACTAGT 1 cut(s) 1357
BfaI CTAG 5 cut(s) 56, 321, 1110, 1358, 1487
BfmI CTRYAG 3 cut(s) 747, 1392, 1450
BfrI CTTAAG 2 cut(s) 1268, 1409
BfuAI ACCTGC 1 cut(s) 951
BfuI GTATCC 1 cut(s) 1474
BisI GCNGC 3 cut(s) 833, 1290, 1395
BlsI GCNGC 3 cut(s) 834, 1291, 1396
Bme1390I CCNGG 1 cut(s) 272
Bme18I GGWCC 1 cut(s) 268
BmeT110I CYCGRG 1 cut(s) 900
BmgT120I GGNCC 2 cut(s) 268, 1366
BmrFI CCNGG 1 cut(s) 272
BmsI GCATC 4 cut(s) 40, 291, 961, 1486
BpmI CTGGAG 1 cut(s) 627
Bpu10I CCTNAGC 1 cut(s) 1284
BpuEI CTTGAG 1 cut(s) 1020
BsaAI YACGTR 1 cut(s) 333
BsaHI GRCGYC 1 cut(s) 1006
Bse3DI GCAATG 2 cut(s) 102, 1533
BseBI CCWGG 1 cut(s) 272
BseGI GGATG 3 cut(s) 270, 355, 976
BseMI GCAATG 2 cut(s) 102, 1533
BseMII CTCAG 2 cut(s) 628, 1527
BseSI GKGCMC 1 cut(s) 225
BseXI GCAGC 3 cut(s) 819, 1301, 1406
BsgI GTGCAG 1 cut(s) 493
BshFI GGCC 2 cut(s) 101, 1368
BsiHKAI GWGCWC 1 cut(s) 225
BsiHKCI CYCGRG 1 cut(s) 900
BsmAI GTCTC 1 cut(s) 689
BsnI GGCC 2 cut(s) 101, 1368
BsoBI CYCGRG 1 cut(s) 900
Bsp1286I GDGCHC 1 cut(s) 225
Bsp143I GATC 1 cut(s) 27
BspACI CCGC 2 cut(s) 364, 1542
BspANI GGCC 2 cut(s) 101, 1368
BspCNI CTCAG 2 cut(s) 627, 1526
BspMAI CTGCAG 2 cut(s) 751, 1396
BspMI ACCTGC 1 cut(s) 951
BspTI CTTAAG 2 cut(s) 1268, 1409
BsrDI GCAATG 2 cut(s) 102, 1533
BssMI GATC 1 cut(s) 27
BssNI GRCGYC 1 cut(s) 1006
Bst2UI CCWGG 1 cut(s) 272
Bst4CI ACNGT 3 cut(s) 38, 467, 1469
Bst6I CTCTTC 2 cut(s) 728, 1514
BstACI GRCGYC 1 cut(s) 1006
BstAFI CTTAAG 2 cut(s) 1268, 1409
BstBAI YACGTR 1 cut(s) 333
BstC8I GCNNGC 3 cut(s) 1331, 1429, 1433
BstDEI CTNAG 4 cut(s) 614, 1195, 1284, 1513
BstF5I GGATG 3 cut(s) 270, 355, 976
BstKTI GATC 1 cut(s) 30
BstMAI GTCTC 1 cut(s) 689
BstMBI GATC 1 cut(s) 27
BstMWI GCNNNNNNNGC 3 cut(s) 1003, 1012, 1289
BstNI CCWGG 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 270
BstSFI CTRYAG 3 cut(s) 747, 1392, 1450
BstSLI GKGCMC 1 cut(s) 225
BstV1I GCAGC 3 cut(s) 819, 1301, 1406
BstXI CCANNNNNNTGG 1 cut(s) 651
BsuI GTATCC 1 cut(s) 1474
BsuRI GGCC 2 cut(s) 101, 1368
BtsCI GGATG 3 cut(s) 270, 355, 976
BtsIMutI CAGTG 1 cut(s) 68
BveI ACCTGC 1 cut(s) 951
Cac8I GCNNGC 3 cut(s) 1331, 1429, 1433
Cfr13I GGNCC 2 cut(s) 268, 1366
CseI GACGC 1 cut(s) 995
Csp6I GTAC 4 cut(s) 324, 334, 658, 1353
CspCI CAANNNNNGTGG 2 cut(s) 267, 302
CviAII CATG 3 cut(s) 498, 1462, 1563
CviQI GTAC 4 cut(s) 324, 334, 658, 1353
DdeI CTNAG 4 cut(s) 614, 1195, 1284, 1513
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Eam1104I CTCTTC 2 cut(s) 728, 1514
EarI CTCTTC 2 cut(s) 728, 1514
Eco47I GGWCC 1 cut(s) 268
Eco88I CYCGRG 1 cut(s) 900
EcoO109I RGGNCCY 1 cut(s) 1366
EcoRI GAATTC 1 cut(s) 531
EcoRII CCWGG 1 cut(s) 270
EcoT22I ATGCAT 1 cut(s) 499
FaeI CATG 3 cut(s) 501, 1465, 1566
FatI CATG 3 cut(s) 497, 1461, 1562
FauI CCCGC 2 cut(s) 357, 1549
FblI GTMKAC 1 cut(s) 18
Fnu4HI GCNGC 3 cut(s) 833, 1290, 1395
FokI GGATG 3 cut(s) 277, 362, 983
Fsp4HI GCNGC 3 cut(s) 833, 1290, 1395
FspBI CTAG 5 cut(s) 56, 321, 1110, 1358, 1487
GluI GCNGC 3 cut(s) 833, 1290, 1395
GsuI CTGGAG 1 cut(s) 627
HaeIII GGCC 2 cut(s) 101, 1368
HgaI GACGC 1 cut(s) 995
Hin1I GRCGYC 1 cut(s) 1006
Hin1II CATG 3 cut(s) 501, 1465, 1566
HincII GTYRAC 1 cut(s) 1049
HindII GTYRAC 1 cut(s) 1049
HinfI GANTC 4 cut(s) 65, 136, 565, 920
HphI GGTGA 1 cut(s) 742
Hpy166II GTNNAC 4 cut(s) 19, 223, 1049, 1355
Hpy188I TCNGA 2 cut(s) 617, 1516
Hpy188III TCNNGA 6 cut(s) 215, 644, 722, 900, 924, 1110
Hpy8I GTNNAC 4 cut(s) 19, 223, 1049, 1355
Hpy99I CGWCG 1 cut(s) 992
HpyAV CCTTC 4 cut(s) 238, 851, 1026, 1415
HpyCH4III ACNGT 3 cut(s) 38, 467, 1469
HpyCH4IV ACGT 2 cut(s) 332, 656
HpyF10VI GCNNNNNNNGC 3 cut(s) 1003, 1012, 1289
HpyF3I CTNAG 4 cut(s) 614, 1195, 1284, 1513
HpySE526I ACGT 2 cut(s) 332, 656
Hsp92I GRCGYC 1 cut(s) 1006
Hsp92II CATG 3 cut(s) 501, 1465, 1566
Kzo9I GATC 1 cut(s) 27
LmnI GCTCC 4 cut(s) 112, 282, 1424, 1543
LpnPI CCDG 9 cut(s) 228, 257, 284, 657, 690, 835, 956, 1347, 1449
Lsp1109I GCAGC 3 cut(s) 819, 1301, 1406
LweI GCATC 4 cut(s) 40, 291, 961, 1486
MaeI CTAG 5 cut(s) 56, 321, 1110, 1358, 1487
MaeII ACGT 2 cut(s) 332, 656
MaeIII GTNAC 4 cut(s) 442, 1231, 1342, 1382
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 7 cut(s) 745, 836, 843, 862, 1256, 1426, 1501
MfeI CAATTG 1 cut(s) 1403
MhlI GDGCHC 1 cut(s) 225
MmeI TCCRAC 2 cut(s) 408, 632
Mph1103I ATGCAT 1 cut(s) 499
MroXI GAANNNNTTC 1 cut(s) 996
MseI TTAA 4 cut(s) 777, 1149, 1269, 1410
MslI CAYNNNNRTG 3 cut(s) 945, 1037, 1460
MspCI CTTAAG 2 cut(s) 1268, 1409
MspR9I CCNGG 1 cut(s) 272
MunI CAATTG 1 cut(s) 1403
MvaI CCWGG 1 cut(s) 272
MwoI GCNNNNNNNGC 3 cut(s) 1003, 1012, 1289
NdeII GATC 1 cut(s) 27
NlaIII CATG 3 cut(s) 501, 1465, 1566
NmuCI GTSAC 1 cut(s) 1231
NsiI ATGCAT 1 cut(s) 499
OliI CACNNNNGTG 2 cut(s) 945, 1037
PaeR7I CTCGAG 1 cut(s) 900
PaqCI CACCTGC 1 cut(s) 951
PdmI GAANNNNTTC 1 cut(s) 996
PfeI GAWTC 4 cut(s) 65, 136, 565, 920
PfoI TCCNGGA 1 cut(s) 270
PkrI GCNGC 3 cut(s) 834, 1291, 1396
Ppu21I YACGTR 1 cut(s) 333
PshBI ATTAAT 1 cut(s) 1149
PsiI TTATAA 1 cut(s) 450
Psp6I CCWGG 1 cut(s) 270
PspGI CCWGG 1 cut(s) 270
PspPI GGNCC 2 cut(s) 268, 1366
PstI CTGCAG 2 cut(s) 751, 1396
RsaI GTAC 4 cut(s) 325, 335, 659, 1354
RsaNI GTAC 4 cut(s) 324, 334, 658, 1353
RseI CAYNNNNRTG 3 cut(s) 945, 1037, 1460
SaqAI TTAA 4 cut(s) 777, 1149, 1269, 1410
SatI GCNGC 3 cut(s) 833, 1290, 1395
Sau3AI GATC 1 cut(s) 27
Sau96I GGNCC 2 cut(s) 268, 1366
ScrFI CCNGG 1 cut(s) 272
SduI GDGCHC 1 cut(s) 225
SfaNI GCATC 4 cut(s) 40, 291, 961, 1486
SfcI CTRYAG 3 cut(s) 747, 1392, 1450
Sfr274I CTCGAG 1 cut(s) 900
SinI GGWCC 1 cut(s) 268
SlaI CTCGAG 1 cut(s) 900
SmiMI CAYNNNNRTG 3 cut(s) 945, 1037, 1460
SmlI CTYRAG 4 cut(s) 900, 1035, 1268, 1409
SmoI CTYRAG 4 cut(s) 900, 1035, 1268, 1409
SpeI ACTAGT 1 cut(s) 1357
SsiI CCGC 2 cut(s) 364, 1542
SspI AATATT 1 cut(s) 454
SspMI CTAG 5 cut(s) 56, 321, 1110, 1358, 1487
StyD4I CCNGG 1 cut(s) 270
TaaI ACNGT 3 cut(s) 38, 467, 1469
TaiI ACGT 2 cut(s) 335, 659
TaqI TCGA 4 cut(s) 33, 673, 901, 987
TatI WGTACW 1 cut(s) 323
TfiI GAWTC 4 cut(s) 65, 136, 565, 920
Tru1I TTAA 4 cut(s) 777, 1149, 1269, 1410
Tru9I TTAA 4 cut(s) 777, 1149, 1269, 1410
TscAI CASTG 1 cut(s) 75
TseFI GTSAC 1 cut(s) 1231
TseI GCWGC 3 cut(s) 832, 1289, 1394
Tsp45I GTSAC 1 cut(s) 1231
TspDTI ATGAA 2 cut(s) 204, 638
TspGWI ACGGA 4 cut(s) 156, 617, 779, 932
TspRI CASTG 1 cut(s) 75
Vha464I CTTAAG 2 cut(s) 1268, 1409
VneI GTGCAC 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 268
VspI ATTAAT 1 cut(s) 1149
XapI RAATTY 1 cut(s) 531
XbaI TCTAGA 1 cut(s) 1109
XhoI CTCGAG 1 cut(s) 900
XmiI GTMKAC 1 cut(s) 18
XmnI GAANNNNTTC 1 cut(s) 996
XspI CTAG 5 cut(s) 56, 321, 1110, 1358, 1487
Zsp2I ATGCAT 1 cut(s) 499
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.