Rh4AG184400

endonuclease activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
45809303 .. 45813131
3829 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG184400.1

Sequence Viewer

Length: 396 bp
ATGAAGGATCAAGGAACCGCCCCTAATGTTGCCACCTTCAACACCCTAATACATGCACTTTGCCAGTCAGGTAAGAGGGAAAAGGCCCACAGATTCTTGTCTTTCATGGCTGAGAGTGGAATTTCACCAAATGTATATACATATAATATCCTAATCAACAGTCACTGCAGGGAAGAAAGAATACAAGAAGCAGTTTCTGTGTTAGAAAAGATGACTAGCAAAGGCATAAAGCCTACTGTTGTCACTTTTAACTCCTTAATTTCTGCTTCATGCAAGTCTGGTCAATGGGAAAAAGCTGTACAGTTATTTAAAATGTGCTACTATGAGGTCGTTTACCTGATTCATGAGAAGCATGCGAAACAGGTGGGGTGTGTAAAGGAGAAAATTGAAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.77

Weight (kDa)

8.98

Isoelectric Point (pI)

35.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_3 PF13812 1 - 53 2.2e-13 Pentatricopeptide repeat domain
PPR_long PF17177 1 - 105 5e-12 Pentacotripeptide-repeat region of PRORP
TPR_24 PF23276 2 - 105 3.7e-12 Fungal tetratrico peptide repeats
PPR_1 PF12854 7 - 36 6.2e-09 PPR repeat
PPR_2 PF13041 8 - 57 3.5e-19 PPR repeat family
PPR_1 PF12854 40 - 72 1.8e-13 PPR repeat
PPR PF01535 46 - 76 1.5e-08 PPR repeat
PPR_2 PF13041 47 - 92 1e-15 PPR repeat family
PPR_3 PF13812 62 - 89 1.1e-06 Pentatricopeptide repeat domain
PPR_1 PF12854 74 - 104 4.1e-11 PPR repeat
PPR_2 PF13041 78 - 104 3.5e-07 PPR repeat family
PPR PF01535 81 - 104 4.7e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 18
AclWI GGATC 1 cut(s) 15
AcsI RAATTY 1 cut(s) 120
AfaI GTAC 1 cut(s) 300
AgsI TTSAA 2 cut(s) 40, 389
AluBI AGCT 1 cut(s) 296
AluI AGCT 1 cut(s) 296
AlwI GGATC 1 cut(s) 15
AlwNI CAGNNNCTG 2 cut(s) 165, 197
AoxI GGCC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 117
BarI GAAGNNNNNNTAC 2 cut(s) 165, 197
BfaI CTAG 1 cut(s) 216
BfmI CTRYAG 1 cut(s) 166
BmgT120I GGNCC 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 64
BshFI GGCC 1 cut(s) 86
BsnI GGCC 1 cut(s) 86
Bsp1407I TGTACA 1 cut(s) 298
Bsp143I GATC 1 cut(s) 7
BspACI CCGC 1 cut(s) 18
BspANI GGCC 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 103
BspHI TCATGA 1 cut(s) 343
BspLI GGNNCC 1 cut(s) 16
BspMAI CTGCAG 1 cut(s) 170
BspPI GGATC 1 cut(s) 15
BsrGI TGTACA 1 cut(s) 298
BsrI ACTGG 1 cut(s) 64
BssMI GATC 1 cut(s) 7
Bst4CI ACNGT 3 cut(s) 161, 238, 303
BstAUI TGTACA 1 cut(s) 298
BstC8I GCNNGC 1 cut(s) 354
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstNSI RCATGY 2 cut(s) 56, 356
BstSFI CTRYAG 1 cut(s) 166
BsuRI GGCC 1 cut(s) 86
BtsI GCAGTG 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 163
Cac8I GCNNGC 1 cut(s) 354
CaiI CAGNNNCTG 2 cut(s) 165, 197
CciI TCATGA 1 cut(s) 343
Cfr13I GGNCC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 299
CviAII CATG 5 cut(s) 53, 106, 270, 344, 353
CviJI RGCY 4 cut(s) 86, 110, 232, 296
CviKI_1 RGCY 4 cut(s) 86, 110, 232, 296
CviQI GTAC 1 cut(s) 299
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
DraI TTTAAA 1 cut(s) 310
FaeI CATG 5 cut(s) 56, 109, 273, 347, 356
FatI CATG 5 cut(s) 52, 105, 269, 343, 352
FspBI CTAG 1 cut(s) 216
HaeIII GGCC 1 cut(s) 86
Hin1II CATG 5 cut(s) 56, 109, 273, 347, 356
HinfI GANTC 2 cut(s) 93, 340
HphI GGTGA 1 cut(s) 117
Hpy166II GTNNAC 1 cut(s) 334
Hpy188III TCNNGA 1 cut(s) 344
Hpy8I GTNNAC 1 cut(s) 334
HpyAV CCTTC 2 cut(s) 46, 383
HpyCH4III ACNGT 3 cut(s) 161, 238, 303
HpyCH4V TGCA 3 cut(s) 56, 168, 273
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 5 cut(s) 56, 109, 273, 347, 356
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 6 cut(s) 54, 77, 154, 264, 347, 350
MaeI CTAG 1 cut(s) 216
MaeIII GTNAC 2 cut(s) 161, 241
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 1 cut(s) 185
MluCI AATT 3 cut(s) 120, 258, 384
MnlI CCTC 2 cut(s) 69, 319
MseI TTAA 3 cut(s) 249, 257, 309
NdeII GATC 1 cut(s) 7
NlaIII CATG 5 cut(s) 56, 109, 273, 347, 356
NlaIV GGNNCC 1 cut(s) 16
NmuCI GTSAC 2 cut(s) 161, 241
NspI RCATGY 2 cut(s) 56, 356
PaeI GCATGC 1 cut(s) 356
PagI TCATGA 1 cut(s) 343
PfeI GAWTC 2 cut(s) 93, 340
PspN4I GGNNCC 1 cut(s) 16
PspPI GGNCC 1 cut(s) 85
PstI CTGCAG 1 cut(s) 170
PstNI CAGNNNCTG 2 cut(s) 165, 197
RsaI GTAC 1 cut(s) 300
RsaNI GTAC 1 cut(s) 299
SaqAI TTAA 3 cut(s) 249, 257, 309
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 85
SetI ASST 7 cut(s) 38, 73, 298, 330, 339, 366, 394
SfcI CTRYAG 1 cut(s) 166
SphI GCATGC 1 cut(s) 356
Sse9I AATT 3 cut(s) 120, 258, 384
SsiI CCGC 1 cut(s) 18
SspMI CTAG 1 cut(s) 216
TaaI ACNGT 3 cut(s) 161, 238, 303
TasI AATT 3 cut(s) 120, 258, 384
TatI WGTACW 1 cut(s) 298
TfiI GAWTC 2 cut(s) 93, 340
Tru1I TTAA 3 cut(s) 249, 257, 309
Tru9I TTAA 3 cut(s) 249, 257, 309
TscAI CASTG 1 cut(s) 170
TseFI GTSAC 2 cut(s) 161, 241
Tsp45I GTSAC 2 cut(s) 161, 241
TspDTI ATGAA 4 cut(s) 17, 94, 258, 332
TspRI CASTG 1 cut(s) 170
XapI RAATTY 1 cut(s) 120
XceI RCATGY 2 cut(s) 56, 356
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.