Rh3DG195400

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
17541469 .. 17541984
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG195400.1

Sequence Viewer

Length: 516 bp
ATGGCAGAAAGAGGTGTGGCTCCAAACTCAGTGTGCTTCACTACTCTGATAGACATATATTGCAAGGAAGGAGACTTTGTCGAAGCAAAGCGGGTATTTCAGGAGATGGAAAGCAAAGGAGAGAGGCCTAATAACGTAACATACAATGCTCTAATTGATGGGCATACCAAGAAAGGTAAACTGAAGGAAGCACATAAGATAAAAGAGGAGATGGAAGACAAGGGTTTGATGGCAGATTCGTATACATATTCATCGCTCATACATGGTGAATGTATTGCTGGCAACGTGGATGCGGCACTGACATTGTTTCATGAAATGTCCCAGAGGGGTTTAACTCGAAACGTTGTCACATACACAGTAATTATTTCGGGTTTGTCTAAGGTGGGGAGAAAAGAAGAAGCTTTCAAATTGTACGATGACATGAAAAAAGCAAGCATCATACCTGATGACAGGGTATATAATTCACTTGTACAAGGCCTTTATACAGACAAGTCTAGCTCTATGACAGATGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

171

Amino Acids

19.16

Weight (kDa)

5.65

Isoelectric Point (pI)

20.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_long PF17177 1 - 94 2.6e-07 Pentacotripeptide-repeat region of PRORP
PPR_3 PF13812 1 - 53 3.7e-10 Pentatricopeptide repeat domain
PPR_1 PF12854 4 - 37 2.8e-11 PPR repeat
PPR_2 PF13041 8 - 54 6e-17 PPR repeat family
PPR PF01535 11 - 40 3.1e-09 PPR repeat
PPR_1 PF12854 40 - 72 1.2e-09 PPR repeat
PPR_2 PF13041 43 - 91 5.4e-17 PPR repeat family
TPR_24 PF23276 45 - 140 7.4e-07 Fungal tetratrico peptide repeats
PPR PF01535 46 - 76 3.1e-08 PPR repeat
PPR_3 PF13812 66 - 123 2.6e-11 Pentatricopeptide repeat domain
PPR_1 PF12854 74 - 107 7.8e-10 PPR repeat
PPR PF01535 81 - 111 3.4e-07 PPR repeat
PPR_2 PF13041 85 - 127 1.4e-11 PPR repeat family
PPR_3 PF13812 102 - 157 4.1e-09 Pentatricopeptide repeat domain
PPR_1 PF12854 109 - 142 6.4e-09 PPR repeat
PPR_2 PF13041 113 - 160 1.7e-15 PPR repeat family
PPR PF01535 116 - 144 9.4e-08 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 242
AciI CCGC 2 cut(s) 91, 293
AclI AACGTT 1 cut(s) 342
AcuI CTGAAG 1 cut(s) 203
AfaI GTAC 2 cut(s) 413, 471
AgsI TTSAA 1 cut(s) 406
AluBI AGCT 2 cut(s) 401, 498
AluI AGCT 2 cut(s) 401, 498
Alw26I GTCTC 1 cut(s) 66
AoxI GGCC 2 cut(s) 125, 475
AsuHPI GGTGA 1 cut(s) 278
BbsI GAAGAC 1 cut(s) 222
BccI CCATC 4 cut(s) 100, 152, 205, 223
BcoDI GTCTC 1 cut(s) 66
BfaI CTAG 1 cut(s) 495
BisI GCNGC 1 cut(s) 294
BlsI GCNGC 1 cut(s) 295
BmiI GGNNCC 1 cut(s) 21
BmsI GCATC 2 cut(s) 280, 444
BpiI GAAGAC 1 cut(s) 222
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
BseGI GGATG 1 cut(s) 295
BseMII CTCAG 1 cut(s) 42
BseRI GAGGAG 1 cut(s) 221
BshFI GGCC 2 cut(s) 127, 477
BslFI GGGAC 1 cut(s) 304
BsmAI GTCTC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 304
BsnI GGCC 2 cut(s) 127, 477
Bsp1407I TGTACA 1 cut(s) 469
BspACI CCGC 2 cut(s) 91, 293
BspANI GGCC 2 cut(s) 127, 477
BspCNI CTCAG 1 cut(s) 41
BspHI TCATGA 1 cut(s) 310
BspLI GGNNCC 1 cut(s) 21
BsrGI TGTACA 1 cut(s) 469
BssNAI GTATAC 1 cut(s) 243
Bst1107I GTATAC 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 358
BstAUI TGTACA 1 cut(s) 469
BstC8I GCNNGC 2 cut(s) 280, 433
BstDEI CTNAG 2 cut(s) 28, 378
BstF5I GGATG 1 cut(s) 295
BstMAI GTCTC 1 cut(s) 66
BstV2I GAAGAC 1 cut(s) 222
BstZ17I GTATAC 1 cut(s) 243
BsuRI GGCC 2 cut(s) 127, 477
BtgZI GCGATG 1 cut(s) 237
BtsCI GGATG 1 cut(s) 295
BtsIMutI CAGTG 2 cut(s) 36, 296
Cac8I GCNNGC 2 cut(s) 280, 433
CciI TCATGA 1 cut(s) 310
Csp6I GTAC 2 cut(s) 412, 470
CviAII CATG 3 cut(s) 263, 311, 421
CviJI RGCY 5 cut(s) 20, 127, 401, 477, 498
CviKI_1 RGCY 5 cut(s) 20, 127, 401, 477, 498
CviQI GTAC 2 cut(s) 412, 470
DdeI CTNAG 2 cut(s) 28, 378
Eco147I AGGCCT 2 cut(s) 127, 477
Eco57I CTGAAG 1 cut(s) 203
FaeI CATG 3 cut(s) 266, 314, 424
FaqI GGGAC 1 cut(s) 304
FatI CATG 3 cut(s) 262, 310, 420
FauI CCCGC 1 cut(s) 84
FblI GTMKAC 1 cut(s) 242
Fnu4HI GCNGC 1 cut(s) 294
FokI GGATG 1 cut(s) 302
Fsp4HI GCNGC 1 cut(s) 294
FspBI CTAG 1 cut(s) 495
GluI GCNGC 1 cut(s) 294
HaeIII GGCC 2 cut(s) 127, 477
Hin1II CATG 3 cut(s) 266, 314, 424
HindIII AAGCTT 1 cut(s) 399
HinfI GANTC 1 cut(s) 236
HphI GGTGA 1 cut(s) 278
Hpy166II GTNNAC 2 cut(s) 179, 243
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 2 cut(s) 101, 311
Hpy8I GTNNAC 2 cut(s) 179, 243
HpyAV CCTTC 2 cut(s) 62, 178
HpyCH4III ACNGT 1 cut(s) 358
HpyCH4IV ACGT 3 cut(s) 135, 285, 342
HpyCH4V TGCA 1 cut(s) 63
HpyF3I CTNAG 2 cut(s) 28, 378
HpySE526I ACGT 3 cut(s) 135, 285, 342
Hsp92II CATG 3 cut(s) 266, 314, 424
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 5 cut(s) 86, 264, 335, 436, 456
LweI GCATC 2 cut(s) 280, 444
MaeI CTAG 1 cut(s) 495
MaeII ACGT 3 cut(s) 135, 285, 342
MaeIII GTNAC 2 cut(s) 136, 346
MboII GAAGA 2 cut(s) 227, 407
MluCI AATT 4 cut(s) 153, 360, 407, 460
MnlI CCTC 4 cut(s) 5, 117, 199, 318
MseI TTAA 1 cut(s) 332
NlaIII CATG 3 cut(s) 266, 314, 424
NlaIV GGNNCC 1 cut(s) 21
NmuCI GTSAC 1 cut(s) 346
PagI TCATGA 1 cut(s) 310
PceI AGGCCT 2 cut(s) 127, 477
PfeI GAWTC 1 cut(s) 236
PflFI GACNNNGTC 1 cut(s) 77
PkrI GCNGC 1 cut(s) 295
Psp1406I AACGTT 1 cut(s) 342
PspN4I GGNNCC 1 cut(s) 21
PsyI GACNNNGTC 1 cut(s) 77
RsaI GTAC 2 cut(s) 413, 471
RsaNI GTAC 2 cut(s) 412, 470
SaqAI TTAA 1 cut(s) 332
SatI GCNGC 1 cut(s) 294
SetI ASST 9 cut(s) 16, 138, 178, 288, 345, 384, 403, 445, 500
SfaNI GCATC 2 cut(s) 280, 444
Sse9I AATT 4 cut(s) 153, 360, 407, 460
SseBI AGGCCT 2 cut(s) 127, 477
SsiI CCGC 2 cut(s) 91, 293
SspMI CTAG 1 cut(s) 495
StuI AGGCCT 2 cut(s) 127, 477
TaaI ACNGT 1 cut(s) 358
TaiI ACGT 3 cut(s) 138, 288, 345
TaqI TCGA 2 cut(s) 81, 337
TasI AATT 4 cut(s) 153, 360, 407, 460
TatI WGTACW 1 cut(s) 469
TauI GCSGC 1 cut(s) 296
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 1 cut(s) 332
Tru9I TTAA 1 cut(s) 332
TscAI CASTG 2 cut(s) 36, 303
TseFI GTSAC 1 cut(s) 346
Tsp45I GTSAC 1 cut(s) 346
TspDTI ATGAA 4 cut(s) 240, 299, 327, 437
TspRI CASTG 2 cut(s) 36, 303
Tth111I GACNNNGTC 1 cut(s) 77
XmiI GTMKAC 1 cut(s) 242
XspI CTAG 1 cut(s) 495
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.