RLG00000008172

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0001472
Physical Location & Seq
Forward (+)
26623230 .. 26623985
756 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008172

Sequence Viewer

Length: 756 bp
ATGAAGATACTTGAGCACATGTATGGAAATGGAAGGTTTAAGCCTGGCCTAGATTGTTACAATCCAATCATTGACAGCCTTTGTAAAGAAAGACGGCTAGATGAGGCTTTGACCCTGTTACATGATATGATCAACACAAGTGTGGTACCAAATGCCATCACTTACAAATCATTGTTTCATGGGTTATGCAATGTGGGTTATTGGGATAAAATACTTGCTCTGTTTGACACAATGAAGGATCAAGGAACCGCCCCTAATGTTGCCACCTTCAACACCCTAATACATGCACTTTGCCAATCAGGTAAGAGGGAAAAGGCCCAAAGATTCTTGTCTTGCATGGCTGAGAATGGAATTCCACCAAATGTATATACATATAATATCCTAATCAACAGTCACTGCAGGGAAGAAAGAATACAAGAAGCAGTTACTGTGTTAGAAAAGATGACTAGCAAAGGCATAAAGCCTACTGTTGTCACTTTTACCTCCTTAATTTATGCTTCATGCAAGTCTGGTCAATGGGAAAAAGATGTACTGTTATTTAAAAGTATGATTGAATTTGGAACCTTGCCTGATATTGTTACCTTCGATGCTATGTTGGATGCTTTATGTAAGAGAGGGAAGACATCAGAGGCACTTAATCTTTTGGAAGAAATGATCCGTAGAGGTGTGAAGCCTGATATTTTCACCTACAACTCCTTAATTCATGGATTATGCCTTTCTAGCAAGTGGAGAGAGGCAACAAGCTTGCTTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_1 PPR_2 PPR_3

Protein Analysis

252

Amino Acids

28.37

Weight (kDa)

7.55

Isoelectric Point (pI)

29.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 14 - 43 2.9e-07 PPR repeat
PPR_2 PF13041 19 - 64 8.1e-14 PPR repeat family
TPR_24 PF23276 20 - 106 5.6e-09 Fungal tetratrico peptide repeats
PPR_3 PF13812 39 - 95 8e-10 Pentatricopeptide repeat domain
PPR_2 PF13041 58 - 99 4.2e-12 PPR repeat family
PPR_long PF17177 71 - 175 1e-11 Pentacotripeptide-repeat region of PRORP
PPR_3 PF13812 74 - 130 3.5e-14 Pentatricopeptide repeat domain
PPR_1 PF12854 84 - 113 4.5e-09 PPR repeat
PPR_2 PF13041 85 - 134 3.7e-18 PPR repeat family
PPR_1 PF12854 116 - 149 9.7e-13 PPR repeat
PPR PF01535 123 - 153 1.5e-07 PPR repeat
PPR_2 PF13041 124 - 169 3e-14 PPR repeat family
PPR_3 PF13812 144 - 204 3.1e-07 Pentatricopeptide repeat domain
PPR_1 PF12854 151 - 183 3.1e-06 PPR repeat
PPR_2 PF13041 155 - 204 3.7e-11 PPR repeat family
PPR_3 PF13812 180 - 235 2.7e-08 Pentatricopeptide repeat domain
PPR_1 PF12854 189 - 218 6.4e-09 PPR repeat
PPR_2 PF13041 190 - 238 1.6e-19 PPR repeat family
PPR PF01535 193 - 223 3.7e-08 PPR repeat
PPR_1 PF12854 221 - 251 1.5e-09 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 145
AccB1I GGYRCC 1 cut(s) 145
AciI CCGC 1 cut(s) 249
AclWI GGATC 2 cut(s) 246, 649
AcsI RAATTY 2 cut(s) 351, 554
AfaI GTAC 2 cut(s) 147, 531
AflIII ACRYGT 1 cut(s) 18
AgsI TTSAA 2 cut(s) 271, 554
AjnI CCWGG 1 cut(s) 43
AleI CACNNNNGTG 1 cut(s) 140
AluBI AGCT 1 cut(s) 744
AluI AGCT 1 cut(s) 744
Alw21I GWGCWC 1 cut(s) 18
AlwI GGATC 2 cut(s) 246, 649
AlwNI CAGNNNCTG 2 cut(s) 396, 428
AoxI GGCC 2 cut(s) 46, 315
ApoI RAATTY 2 cut(s) 351, 554
Asp718I GGTACC 1 cut(s) 145
AspS9I GGNCC 1 cut(s) 316
AsuHPI GGTGA 1 cut(s) 676
BanI GGYRCC 1 cut(s) 145
BarI GAAGNNNNNNTAC 2 cut(s) 396, 428
BbsI GAAGAC 1 cut(s) 626
Bbv12I GWGCWC 1 cut(s) 18
BccI CCATC 1 cut(s) 164
BceAI ACGGC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 45
BclI TGATCA 1 cut(s) 129
BfaI CTAG 4 cut(s) 50, 98, 447, 720
BfmI CTRYAG 1 cut(s) 397
Bme1390I CCNGG 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 316
BmiI GGNNCC 3 cut(s) 147, 247, 562
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 2 cut(s) 577, 589
BpiI GAAGAC 1 cut(s) 626
BpuEI CTTGAG 1 cut(s) 32
Bse3DI GCAATG 1 cut(s) 196
BseBI CCWGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 604
BseMI GCAATG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 333
BshFI GGCC 2 cut(s) 48, 317
BshNI GGYRCC 1 cut(s) 145
BsiHKAI GWGCWC 1 cut(s) 18
BsnI GGCC 2 cut(s) 48, 317
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 3 cut(s) 129, 238, 654
BspACI CCGC 1 cut(s) 249
BspANI GGCC 2 cut(s) 48, 317
BspCNI CTCAG 1 cut(s) 334
BspLI GGNNCC 3 cut(s) 147, 247, 562
BspMAI CTGCAG 1 cut(s) 401
BspPI GGATC 2 cut(s) 246, 649
BspT107I GGYRCC 1 cut(s) 145
BsrDI GCAATG 1 cut(s) 196
BssMI GATC 3 cut(s) 129, 238, 654
Bst2UI CCWGG 1 cut(s) 45
Bst4CI ACNGT 4 cut(s) 392, 430, 469, 534
BstC8I GCNNGC 1 cut(s) 746
BstDEI CTNAG 1 cut(s) 342
BstF5I GGATG 1 cut(s) 604
BstKTI GATC 3 cut(s) 132, 241, 657
BstMBI GATC 3 cut(s) 129, 238, 654
BstMWI GCNNNNNNNGC 1 cut(s) 720
BstNI CCWGG 1 cut(s) 45
BstNSI RCATGY 2 cut(s) 22, 287
BstSCI CCNGG 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 397
BstV2I GAAGAC 1 cut(s) 626
BsuRI GGCC 2 cut(s) 48, 317
BtsCI GGATG 1 cut(s) 604
BtsI GCAGTG 1 cut(s) 394
BtsIMutI CAGTG 1 cut(s) 394
Cac8I GCNNGC 1 cut(s) 746
CaiI CAGNNNCTG 2 cut(s) 396, 428
Cfr13I GGNCC 1 cut(s) 316
Csp6I GTAC 2 cut(s) 146, 530
CviAII CATG 7 cut(s) 19, 122, 179, 284, 337, 501, 704
CviQI GTAC 2 cut(s) 146, 530
DdeI CTNAG 1 cut(s) 342
DpnI GATC 3 cut(s) 131, 240, 656
DpnII GATC 3 cut(s) 129, 238, 654
DraI TTTAAA 1 cut(s) 541
EcoRI GAATTC 1 cut(s) 351
EcoRII CCWGG 1 cut(s) 43
FaeI CATG 7 cut(s) 22, 125, 182, 287, 340, 504, 707
FatI CATG 7 cut(s) 18, 121, 178, 283, 336, 500, 703
FbaI TGATCA 1 cut(s) 129
FokI GGATG 1 cut(s) 611
FspBI CTAG 4 cut(s) 50, 98, 447, 720
HaeIII GGCC 2 cut(s) 48, 317
Hin1II CATG 7 cut(s) 22, 125, 182, 287, 340, 504, 707
HindIII AAGCTT 1 cut(s) 742
HinfI GANTC 1 cut(s) 324
HphI GGTGA 1 cut(s) 676
Hpy188I TCNGA 1 cut(s) 628
HpyAV CCTTC 4 cut(s) 27, 229, 277, 592
HpyCH4III ACNGT 4 cut(s) 392, 430, 469, 534
HpyCH4V TGCA 5 cut(s) 189, 287, 336, 399, 504
HpyF10VI GCNNNNNNNGC 1 cut(s) 720
HpyF3I CTNAG 1 cut(s) 342
Hsp92II CATG 7 cut(s) 22, 125, 182, 287, 340, 504, 707
KpnI GGTACC 1 cut(s) 149
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 3 cut(s) 129, 238, 654
LpnPI CCDG 8 cut(s) 30, 57, 128, 285, 385, 495, 582, 687
LweI GCATC 2 cut(s) 577, 589
MaeI CTAG 4 cut(s) 50, 98, 447, 720
MaeIII GTNAC 6 cut(s) 56, 117, 392, 424, 472, 577
MalI GATC 3 cut(s) 131, 240, 656
MboI GATC 3 cut(s) 129, 238, 654
MboII GAAGA 4 cut(s) 16, 416, 631, 659
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 4 cut(s) 351, 489, 554, 699
MmeI TCCRAC 1 cut(s) 576
MnlI CCTC 7 cut(s) 97, 300, 493, 608, 622, 656, 727
MseI TTAA 5 cut(s) 39, 488, 540, 636, 698
MslI CAYNNNNRTG 2 cut(s) 21, 140
MspR9I CCNGG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 720
NdeII GATC 3 cut(s) 129, 238, 654
NlaIII CATG 7 cut(s) 22, 125, 182, 287, 340, 504, 707
NlaIV GGNNCC 3 cut(s) 147, 247, 562
NmuCI GTSAC 2 cut(s) 392, 472
NspI RCATGY 2 cut(s) 22, 287
OliI CACNNNNGTG 1 cut(s) 140
PciI ACATGT 1 cut(s) 18
PfeI GAWTC 1 cut(s) 324
PscI ACATGT 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PspN4I GGNNCC 3 cut(s) 147, 247, 562
PspPI GGNCC 1 cut(s) 316
PstI CTGCAG 1 cut(s) 401
PstNI CAGNNNCTG 2 cut(s) 396, 428
RsaI GTAC 2 cut(s) 147, 531
RsaNI GTAC 2 cut(s) 146, 530
RseI CAYNNNNRTG 2 cut(s) 21, 140
SaqAI TTAA 5 cut(s) 39, 488, 540, 636, 698
Sau3AI GATC 3 cut(s) 129, 238, 654
Sau96I GGNCC 1 cut(s) 316
ScrFI CCNGG 1 cut(s) 45
SduI GDGCHC 1 cut(s) 18
SetI ASST 9 cut(s) 38, 269, 304, 485, 566, 584, 667, 689, 746
SfaNI GCATC 2 cut(s) 577, 589
SfcI CTRYAG 1 cut(s) 397
SmiMI CAYNNNNRTG 2 cut(s) 21, 140
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 4 cut(s) 351, 489, 554, 699
SsiI CCGC 1 cut(s) 249
SspMI CTAG 4 cut(s) 50, 98, 447, 720
StyD4I CCNGG 1 cut(s) 43
TaaI ACNGT 4 cut(s) 392, 430, 469, 534
TaqI TCGA 1 cut(s) 585
TasI AATT 4 cut(s) 351, 489, 554, 699
TatI WGTACW 1 cut(s) 529
TfiI GAWTC 1 cut(s) 324
Tru1I TTAA 5 cut(s) 39, 488, 540, 636, 698
Tru9I TTAA 5 cut(s) 39, 488, 540, 636, 698
TscAI CASTG 1 cut(s) 401
TseFI GTSAC 2 cut(s) 392, 472
Tsp45I GTSAC 2 cut(s) 392, 472
TspDTI ATGAA 5 cut(s) 17, 167, 248, 489, 692
TspGWI ACGGA 1 cut(s) 647
TspRI CASTG 1 cut(s) 401
XapI RAATTY 2 cut(s) 351, 554
XceI RCATGY 2 cut(s) 22, 287
XspI CTAG 4 cut(s) 50, 98, 447, 720
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.