Rmu_sc0012180.1_g000010

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012180.1
Physical Location & Seq
Forward (+)
31841 .. 32155
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012180.1_g000010.1.cds

Sequence Viewer

Length: 315 bp
atggcttttgacgttttcaatgatatgttagagaagggaatcaccgctgatgtggttttgtataatgcactcattagcgggctttgcagggcttcaagagtgactgaagccatgcatttatatgaggaaatgcagactagaggatgctgtcctgatgaggtaactttcaaagtgataattagaggtcttataagagacaagaggctttctgtggcttgtggggtatgggatgagatgatggagaagggctttactctggacagagttctttcccagacactgattaatgctgtccattcaaaagatgttgcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.7

Weight (kDa)

5.28

Isoelectric Point (pI)

24.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 191
AciI CCGC 2 cut(s) 45, 78
AcuI CTGAAG 1 cut(s) 126
AgsI TTSAA 4 cut(s) 19, 96, 169, 300
Alw26I GTCTC 1 cut(s) 189
AlwNI CAGNNNCTG 1 cut(s) 280
AseI ATTAAT 1 cut(s) 285
AsuHPI GGTGA 1 cut(s) 34
BccI CCATC 1 cut(s) 232
BcoDI GTCTC 1 cut(s) 189
BfaI CTAG 1 cut(s) 138
BmsI GCATC 1 cut(s) 134
BseGI GGATG 2 cut(s) 149, 235
BsmAI GTCTC 1 cut(s) 189
BspACI CCGC 2 cut(s) 45, 78
BstC8I GCNNGC 1 cut(s) 80
BstF5I GGATG 2 cut(s) 149, 235
BstMAI GTCTC 1 cut(s) 189
BstMWI GCNNNNNNNGC 1 cut(s) 84
BtsCI GGATG 2 cut(s) 149, 235
BtsIMutI CAGTG 1 cut(s) 278
Cac8I GCNNGC 1 cut(s) 80
CaiI CAGNNNCTG 1 cut(s) 280
CviAII CATG 2 cut(s) 112, 312
CviJI RGCY 7 cut(s) 5, 82, 92, 110, 205, 215, 249
CviKI_1 RGCY 7 cut(s) 5, 82, 92, 110, 205, 215, 249
Eco57I CTGAAG 1 cut(s) 126
EcoT22I ATGCAT 1 cut(s) 117
FaeI CATG 2 cut(s) 115, 315
FaiI YATR 8 cut(s) 26, 63, 113, 121, 123, 191, 226, 313
FatI CATG 2 cut(s) 111, 311
FauI CCCGC 1 cut(s) 71
FokI GGATG 2 cut(s) 156, 242
FspBI CTAG 1 cut(s) 138
Hin1II CATG 2 cut(s) 115, 315
HinfI GANTC 1 cut(s) 39
HphI GGTGA 1 cut(s) 34
Hpy188III TCNNGA 3 cut(s) 96, 152, 257
HpyAV CCTTC 2 cut(s) 28, 238
HpyCH4IV ACGT 1 cut(s) 12
HpyCH4V TGCA 5 cut(s) 68, 87, 115, 133, 311
HpyF10VI GCNNNNNNNGC 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 12
Hsp92II CATG 2 cut(s) 115, 315
LpnPI CCDG 4 cut(s) 73, 165, 242, 287
LweI GCATC 1 cut(s) 134
MaeI CTAG 1 cut(s) 138
MaeII ACGT 1 cut(s) 12
MaeIII GTNAC 2 cut(s) 100, 160
MluCI AATT 1 cut(s) 177
MnlI CCTC 5 cut(s) 118, 134, 151, 176, 195
Mph1103I ATGCAT 1 cut(s) 117
MseI TTAA 1 cut(s) 285
MslI CAYNNNNRTG 1 cut(s) 120
MspA1I CMGCKG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 84
NlaIII CATG 2 cut(s) 115, 315
NmuCI GTSAC 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 117
PfeI GAWTC 1 cut(s) 39
PshBI ATTAAT 1 cut(s) 285
PsiI TTATAA 1 cut(s) 191
PstNI CAGNNNCTG 1 cut(s) 280
RseI CAYNNNNRTG 1 cut(s) 120
SaqAI TTAA 1 cut(s) 285
SetI ASST 3 cut(s) 15, 162, 187
SfaNI GCATC 1 cut(s) 134
SmiMI CAYNNNNRTG 1 cut(s) 120
Sse9I AATT 1 cut(s) 177
SsiI CCGC 2 cut(s) 45, 78
SspMI CTAG 1 cut(s) 138
TaiI ACGT 1 cut(s) 15
TasI AATT 1 cut(s) 177
TfiI GAWTC 1 cut(s) 39
Tru1I TTAA 1 cut(s) 285
Tru9I TTAA 1 cut(s) 285
TscAI CASTG 1 cut(s) 285
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
TspRI CASTG 1 cut(s) 285
VspI ATTAAT 1 cut(s) 285
XspI CTAG 1 cut(s) 138
Zsp2I ATGCAT 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.