pycom14g08210

Serine threonine-protein phosphatase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
8805271 .. 8805465
195 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g08210.1

Sequence Viewer

Length: 195 bp
ATGCTCTCTACTTGGAAGCCTCATGAAAAGATGCAGGAAAAGCTACATGGTACTGATTTTGACAAATTATATGAATTATCCACAATTCTTGTCGAGCATGCTCATGATAATAATATGTTATATGCTCTTGTCACTTTTAGGATAAAAAAAGAAAAGAAAAGAAGGGAAATAGATAGAAATAGGCATTTTTCTTAA

Protein Analysis

65

Amino Acids

7.85

Weight (kDa)

9.4

Isoelectric Point (pI)

28.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 52
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
BmsI GCATC 1 cut(s) 21
BspHI TCATGA 2 cut(s) 22, 103
BstC8I GCNNGC 1 cut(s) 99
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstNSI RCATGY 1 cut(s) 101
Cac8I GCNNGC 1 cut(s) 99
CciI TCATGA 2 cut(s) 22, 103
Csp6I GTAC 1 cut(s) 51
CspCI CAANNNNNGTGG 2 cut(s) 70, 105
CviAII CATG 4 cut(s) 23, 47, 98, 104
CviJI RGCY 2 cut(s) 19, 43
CviKI_1 RGCY 2 cut(s) 19, 43
CviQI GTAC 1 cut(s) 51
FaeI CATG 4 cut(s) 26, 50, 101, 107
FaiI YATR 9 cut(s) 24, 48, 70, 72, 99, 105, 116, 121, 123
FatI CATG 4 cut(s) 22, 46, 97, 103
FspEI CC 8 cut(s) 20, 33, 33, 94, 124, 148, 149, 166
Hin1II CATG 4 cut(s) 26, 50, 101, 107
Hpy188III TCNNGA 2 cut(s) 23, 104
HpyAV CCTTC 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 34
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
Hsp92II CATG 4 cut(s) 26, 50, 101, 107
LpnPI CCDG 1 cut(s) 20
LweI GCATC 1 cut(s) 21
MaeIII GTNAC 1 cut(s) 130
MluCI AATT 3 cut(s) 65, 74, 84
MnlI CCTC 1 cut(s) 30
MseI TTAA 1 cut(s) 193
MslI CAYNNNNRTG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 40
NlaIII CATG 4 cut(s) 26, 50, 101, 107
NmuCI GTSAC 1 cut(s) 130
NspI RCATGY 1 cut(s) 101
PaeI GCATGC 1 cut(s) 101
PagI TCATGA 2 cut(s) 22, 103
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 102
SaqAI TTAA 1 cut(s) 193
SetI ASST 1 cut(s) 45
SfaNI GCATC 1 cut(s) 21
SgeI CNNG 9 cut(s) 24, 35, 47, 59, 101, 106, 110, 116, 140
SmiMI CAYNNNNRTG 1 cut(s) 102
SphI GCATGC 1 cut(s) 101
Sse9I AATT 3 cut(s) 65, 74, 84
TaqI TCGA 1 cut(s) 93
TasI AATT 3 cut(s) 65, 74, 84
Tru1I TTAA 1 cut(s) 193
Tru9I TTAA 1 cut(s) 193
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
TspDTI ATGAA 2 cut(s) 39, 87
XceI RCATGY 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.