Rmu_sc0004145.1_g000014

Serine threonine-protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004145.1
Physical Location & Seq
Reverse (-)
103866 .. 104875
1010 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004145.1_g000014.1.cds

Sequence Viewer

Length: 627 bp
atgacttctttcaaaactacaaaccgaatcgaaccgcctgtttcggctcggtccggaccggttccatcggttttcgtagcaaggcttttgggtcgatgtcatcatgacaatgctatggttcaggctcctatacatacttatagtgttgaggataatgtttttagagttcaaggaagaaccggtgatcgatgggacaggaagaaggatgcaaccatcaatgtaagagggttgggtgaggtgcctactagtcgcatgaagccagatggttatgctgttaagttcaattggttgagggaaacatatcaaactctacctcaaaatttagagccagatacattggctattcatgttaccgctttttgcctctacattgtaggcggggtattattagccactaatgatcacaagtatgtgaacttgtgctacttgaagagtttgcctagggagggacttaggcaatatgcatggggacatgcattcctcgctcacatgcactattgtatggtgtcttgtgcgtcgaatgacaacaagatgtctataggtgctcacatgttcatgctcatggtgtgggcgatcgagcatatcctagaaactcaactgccggaccttgaagcgtcgtcgctgtag

Protein Analysis

208

Amino Acids

23.55

Weight (kDa)

8.28

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 238
AccIII TCCGGA 1 cut(s) 53
AciI CCGC 3 cut(s) 35, 354, 378
AcsI RAATTY 1 cut(s) 319
AfiI CCNNNNNNNGG 1 cut(s) 446
AflIII ACRYGT 1 cut(s) 549
AgeI ACCGGT 2 cut(s) 58, 179
AgsI TTSAA 5 cut(s) 13, 170, 283, 430, 611
AhlI ACTAGT 1 cut(s) 245
Alw21I GWGCWC 1 cut(s) 547
Aor13HI TCCGGA 1 cut(s) 53
ApoI RAATTY 1 cut(s) 319
AsiGI ACCGGT 2 cut(s) 58, 179
AspA2I CCTAGG 1 cut(s) 440
AspS9I GGNCC 3 cut(s) 51, 56, 604
AsuHPI GGTGA 2 cut(s) 194, 245
AvaII GGWCC 3 cut(s) 51, 56, 604
AvrII CCTAGG 1 cut(s) 440
BanI GGYRCC 1 cut(s) 238
Bbv12I GWGCWC 1 cut(s) 547
BccI CCATC 4 cut(s) 73, 183, 221, 257
BclI TGATCA 1 cut(s) 400
BcuI ACTAGT 1 cut(s) 245
BfaI CTAG 3 cut(s) 246, 441, 587
BfmI CTRYAG 2 cut(s) 537, 623
BlnI CCTAGG 1 cut(s) 440
Bme18I GGWCC 3 cut(s) 51, 56, 604
BmgT120I GGNCC 3 cut(s) 51, 56, 604
BmiI GGNNCC 3 cut(s) 63, 126, 240
BmsI GCATC 1 cut(s) 196
Bsa29I ATCGAT 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 440
BsaWI WCCGGW 3 cut(s) 53, 58, 179
Bsc4I CCNNNNNNNGG 1 cut(s) 446
Bse118I RCCGGY 2 cut(s) 58, 179
BseAI TCCGGA 1 cut(s) 53
BseCI ATCGAT 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 440
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 446
Bsh1285I CGRYCG 1 cut(s) 576
BshNI GGYRCC 1 cut(s) 238
BshTI ACCGGT 2 cut(s) 58, 179
BshVI ATCGAT 1 cut(s) 187
BsiEI CGRYCG 1 cut(s) 576
BsiHKAI GWGCWC 1 cut(s) 547
BsiSI CCGG 4 cut(s) 54, 59, 180, 602
BslFI GGGAC 3 cut(s) 206, 462, 483
BslI CCNNNNNNNGG 1 cut(s) 446
BsmFI GGGAC 3 cut(s) 206, 462, 483
BsmI GAATGC 1 cut(s) 476
Bsp1286I GDGCHC 1 cut(s) 547
Bsp13I TCCGGA 1 cut(s) 53
Bsp143I GATC 3 cut(s) 184, 400, 573
BspACI CCGC 3 cut(s) 35, 354, 378
BspDI ATCGAT 1 cut(s) 187
BspEI TCCGGA 1 cut(s) 53
BspHI TCATGA 1 cut(s) 103
BspLI GGNNCC 3 cut(s) 63, 126, 240
BspT107I GGYRCC 1 cut(s) 238
BsrFI RCCGGY 2 cut(s) 58, 179
BssAI RCCGGY 2 cut(s) 58, 179
BssECI CCNNGG 1 cut(s) 440
BssMI GATC 3 cut(s) 184, 400, 573
BssT1I CCWWGG 1 cut(s) 440
Bst6I CTCTTC 1 cut(s) 425
BstDEI CTNAG 1 cut(s) 452
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 3 cut(s) 187, 403, 576
BstMBI GATC 3 cut(s) 184, 400, 573
BstMCI CGRYCG 1 cut(s) 576
BstMWI GCNNNNNNNGC 1 cut(s) 482
BstNSI RCATGY 3 cut(s) 476, 493, 553
BstSFI CTRYAG 2 cut(s) 537, 623
Bsu15I ATCGAT 1 cut(s) 187
BsuTUI ATCGAT 1 cut(s) 187
BtsCI GGATG 1 cut(s) 211
CciI TCATGA 1 cut(s) 103
Cfr10I RCCGGY 2 cut(s) 58, 179
Cfr13I GGNCC 3 cut(s) 51, 56, 604
ClaI ATCGAT 1 cut(s) 187
CpoI CGGWCCG 2 cut(s) 51, 56
CseI GACGC 2 cut(s) 504, 603
CspAI ACCGGT 2 cut(s) 58, 179
CspI CGGWCCG 2 cut(s) 51, 56
CviAII CATG 9 cut(s) 104, 253, 347, 465, 473, 490, 550, 556, 562
CviJI RGCY 7 cut(s) 47, 85, 125, 259, 328, 341, 392
CviKI_1 RGCY 7 cut(s) 47, 85, 125, 259, 328, 341, 392
DdeI CTNAG 1 cut(s) 452
DpnI GATC 3 cut(s) 186, 402, 575
DpnII GATC 3 cut(s) 184, 400, 573
Eam1104I CTCTTC 1 cut(s) 425
EarI CTCTTC 1 cut(s) 425
Eco130I CCWWGG 1 cut(s) 440
Eco47I GGWCC 3 cut(s) 51, 56, 604
EcoT14I CCWWGG 1 cut(s) 440
EcoT22I ATGCAT 2 cut(s) 466, 478
ErhI CCWWGG 1 cut(s) 440
FaeI CATG 9 cut(s) 107, 256, 350, 468, 476, 493, 553, 559, 565
FaqI GGGAC 3 cut(s) 206, 462, 483
FatI CATG 9 cut(s) 103, 252, 346, 464, 472, 489, 549, 555, 561
FauI CCCGC 1 cut(s) 371
FbaI TGATCA 1 cut(s) 400
FokI GGATG 1 cut(s) 218
FspBI CTAG 3 cut(s) 246, 441, 587
HapII CCGG 4 cut(s) 54, 59, 180, 602
HgaI GACGC 2 cut(s) 504, 603
Hin1II CATG 9 cut(s) 107, 256, 350, 468, 476, 493, 553, 559, 565
HinfI GANTC 1 cut(s) 27
HpaII CCGG 4 cut(s) 54, 59, 180, 602
HphI GGTGA 2 cut(s) 194, 245
Hpy166II GTNNAC 1 cut(s) 415
Hpy188III TCNNGA 2 cut(s) 54, 104
Hpy8I GTNNAC 1 cut(s) 415
Hpy99I CGWCG 3 cut(s) 520, 619, 622
HpyAV CCTTC 1 cut(s) 196
HpyCH4V TGCA 4 cut(s) 209, 464, 476, 493
HpyF10VI GCNNNNNNNGC 1 cut(s) 482
HpyF3I CTNAG 1 cut(s) 452
Hsp92II CATG 9 cut(s) 107, 256, 350, 468, 476, 493, 553, 559, 565
Kpn2I TCCGGA 1 cut(s) 53
Ksp22I TGATCA 1 cut(s) 400
Kzo9I GATC 3 cut(s) 184, 400, 573
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 9 cut(s) 51, 67, 72, 107, 181, 193, 273, 342, 615
LweI GCATC 1 cut(s) 196
MaeI CTAG 3 cut(s) 246, 441, 587
MaeIII GTNAC 1 cut(s) 349
MalI GATC 3 cut(s) 186, 402, 575
MboI GATC 3 cut(s) 184, 400, 573
MboII GAAGA 3 cut(s) 186, 211, 442
MfeI CAATTG 1 cut(s) 283
MhlI GDGCHC 1 cut(s) 547
MluCI AATT 2 cut(s) 283, 319
MnlI CCTC 8 cut(s) 142, 218, 229, 285, 324, 374, 439, 491
Mph1103I ATGCAT 2 cut(s) 466, 478
MroI TCCGGA 1 cut(s) 53
MseI TTAA 1 cut(s) 276
MslI CAYNNNNRTG 4 cut(s) 108, 408, 554, 560
MspI CCGG 4 cut(s) 54, 59, 180, 602
MunI CAATTG 1 cut(s) 283
Mva1269I GAATGC 1 cut(s) 476
MwoI GCNNNNNNNGC 1 cut(s) 482
NdeII GATC 3 cut(s) 184, 400, 573
NlaIII CATG 9 cut(s) 107, 256, 350, 468, 476, 493, 553, 559, 565
NlaIV GGNNCC 3 cut(s) 63, 126, 240
NsiI ATGCAT 2 cut(s) 466, 478
NspI RCATGY 3 cut(s) 476, 493, 553
PagI TCATGA 1 cut(s) 103
PciI ACATGT 1 cut(s) 549
PctI GAATGC 1 cut(s) 476
PfeI GAWTC 1 cut(s) 27
PinAI ACCGGT 2 cut(s) 58, 179
Ple19I CGATCG 1 cut(s) 576
PscI ACATGT 1 cut(s) 549
PspN4I GGNNCC 3 cut(s) 63, 126, 240
PspPI GGNCC 3 cut(s) 51, 56, 604
PsrI GAACNNNNNNTAC 2 cut(s) 407, 439
PvuI CGATCG 1 cut(s) 576
RseI CAYNNNNRTG 4 cut(s) 108, 408, 554, 560
Rsr2I CGGWCCG 2 cut(s) 51, 56
RsrII CGGWCCG 2 cut(s) 51, 56
SaqAI TTAA 1 cut(s) 276
Sau3AI GATC 3 cut(s) 184, 400, 573
Sau96I GGNCC 3 cut(s) 51, 56, 604
SduI GDGCHC 1 cut(s) 547
SetI ASST 4 cut(s) 240, 316, 544, 609
SfaNI GCATC 1 cut(s) 196
SfcI CTRYAG 2 cut(s) 537, 623
SinI GGWCC 3 cut(s) 51, 56, 604
SmiMI CAYNNNNRTG 4 cut(s) 108, 408, 554, 560
SpeI ACTAGT 1 cut(s) 245
Sse9I AATT 2 cut(s) 283, 319
SsiI CCGC 3 cut(s) 35, 354, 378
SspMI CTAG 3 cut(s) 246, 441, 587
StyI CCWWGG 1 cut(s) 440
TaqI TCGA 5 cut(s) 30, 94, 187, 518, 576
TaqII GACCGA 1 cut(s) 39
TasI AATT 2 cut(s) 283, 319
TfiI GAWTC 1 cut(s) 27
Tru1I TTAA 1 cut(s) 276
Tru9I TTAA 1 cut(s) 276
TspDTI ATGAA 3 cut(s) 269, 335, 544
VpaK11BI GGWCC 3 cut(s) 51, 56, 604
XapI RAATTY 1 cut(s) 319
XceI RCATGY 3 cut(s) 476, 493, 553
XmaJI CCTAGG 1 cut(s) 440
XspI CTAG 3 cut(s) 246, 441, 587
Zsp2I ATGCAT 2 cut(s) 466, 478
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.