Rh7AG336300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0001459
Physical Location & Seq
Reverse (-)
39100679 .. 39101112
434 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG336300.1

Sequence Viewer

Length: 186 bp
ATGGTGGATGTGAGCGGTTGTTGCCCCTTGTGGCAAATTAAAATCTCAGACAAGACTGTTAAAGAAGTAACAGTACGGAACTGGACAAAACATAAAGCAGAGTGGGATAACTTTGAACAAAGTTTTGTGACCGGGACACCTTTGGCTGGTGATGGTAGCTCCGCCTTGAGAAGCAATGGTATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.74

Weight (kDa)

6.53

Isoelectric Point (pI)

21.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 15
AciI CCGC 2 cut(s) 15, 162
AfaI GTAC 1 cut(s) 75
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 1 cut(s) 116
AluBI AGCT 1 cut(s) 159
AluI AGCT 1 cut(s) 159
AsuC2I CCSGG 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 161
BarI GAAGNNNNNNTAC 2 cut(s) 57, 89
BccI CCATC 1 cut(s) 146
BcnI CCSGG 1 cut(s) 133
Bme1390I CCNGG 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 133
BpuMI CCSGG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 86
Bse3DI GCAATG 1 cut(s) 181
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMI GCAATG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 86
BsiSI CCGG 1 cut(s) 132
BslFI GGGAC 1 cut(s) 148
BslI CCNNNNNNNGG 1 cut(s) 146
BsmFI GGGAC 1 cut(s) 148
BspACI CCGC 2 cut(s) 15, 162
BspCNI CTCAG 1 cut(s) 59
BsrBI CCGCTC 1 cut(s) 15
BsrDI GCAATG 1 cut(s) 181
BsrI ACTGG 1 cut(s) 86
Bst4CI ACNGT 2 cut(s) 58, 73
BstDEI CTNAG 1 cut(s) 46
BstF5I GGATG 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 131
BtsCI GGATG 1 cut(s) 13
Csp6I GTAC 1 cut(s) 74
CviJI RGCY 2 cut(s) 146, 159
CviKI_1 RGCY 2 cut(s) 146, 159
CviQI GTAC 1 cut(s) 74
DdeI CTNAG 1 cut(s) 46
EciI GGCGGA 1 cut(s) 151
FaiI YATR 1 cut(s) 93
FaqI GGGAC 1 cut(s) 148
FokI GGATG 1 cut(s) 20
HapII CCGG 1 cut(s) 132
HpaII CCGG 1 cut(s) 132
HphI GGTGA 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 49
HpyCH4III ACNGT 2 cut(s) 58, 73
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
HpyF3I CTNAG 1 cut(s) 46
LmnI GCTCC 1 cut(s) 164
LpnPI CCDG 3 cut(s) 67, 132, 145
MaeIII GTNAC 2 cut(s) 67, 127
MbiI CCGCTC 1 cut(s) 15
MluCI AATT 1 cut(s) 36
MseI TTAA 2 cut(s) 39, 60
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 133
MwoI GCNNNNNNNGC 1 cut(s) 21
NciI CCSGG 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 127
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
SaqAI TTAA 2 cut(s) 39, 60
ScrFI CCNGG 1 cut(s) 133
SetI ASST 2 cut(s) 142, 161
SgeI CNNG 7 cut(s) 40, 64, 94, 144, 145, 159, 178
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 1 cut(s) 36
SsiI CCGC 2 cut(s) 15, 162
StyD4I CCNGG 1 cut(s) 131
TaaI ACNGT 2 cut(s) 58, 73
TasI AATT 1 cut(s) 36
Tru1I TTAA 2 cut(s) 39, 60
Tru9I TTAA 2 cut(s) 39, 60
TseFI GTSAC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 127
TspGWI ACGGA 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.