pycom14g11260

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
14234206 .. 14234439
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGAACTCCGCAACTACAATTGGTTTTATAATTAGGAACGAAGATGAAACTTCGATTGTGGTTGGAGCTCGTTGTCTGGGGCATAACACAATCTTCATTACTGAAGGTTTTGCCTTGACAGACGCTCTTTGGATGGCAAACGGAAGAAGCTGTAGACGGGTCTGTGTAGAGACTAGTACATGGTTTCAATTTAATGGTTTTTATATTTGGGATAGGTCGTTGCATGTTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.75

Weight (kDa)

6.02

Isoelectric Point (pI)

43.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 29
AccI GTMKAC 1 cut(s) 154
AciI CCGC 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 178
AgsI TTSAA 1 cut(s) 188
AhlI ACTAGT 1 cut(s) 173
AluBI AGCT 2 cut(s) 68, 150
AluI AGCT 2 cut(s) 68, 150
Alw21I GWGCWC 1 cut(s) 70
Alw26I GTCTC 1 cut(s) 164
BanII GRGCYC 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 70
BccI CCATC 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 164
BcuI ACTAGT 1 cut(s) 173
BfaI CTAG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 151
BseGI GGATG 1 cut(s) 138
BsiHKAI GWGCWC 1 cut(s) 70
BsmAI GTCTC 1 cut(s) 164
Bsp1286I GDGCHC 1 cut(s) 70
BspACI CCGC 1 cut(s) 9
BstF5I GGATG 1 cut(s) 138
BstMAI GTCTC 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 227
BstSFI CTRYAG 1 cut(s) 151
BtsCI GGATG 1 cut(s) 138
CseI GACGC 1 cut(s) 131
Csp6I GTAC 1 cut(s) 177
CviAII CATG 2 cut(s) 180, 224
CviJI RGCY 2 cut(s) 68, 150
CviKI_1 RGCY 2 cut(s) 68, 150
CviQI GTAC 1 cut(s) 177
Ecl136II GAGCTC 1 cut(s) 68
Eco24I GRGCYC 1 cut(s) 70
Eco53kI GAGCTC 1 cut(s) 68
Eco57I CTGAAG 1 cut(s) 123
EcoICRI GAGCTC 1 cut(s) 68
EcoT38I GRGCYC 1 cut(s) 70
FaeI CATG 2 cut(s) 183, 227
FaiI YATR 5 cut(s) 29, 84, 181, 204, 225
FatI CATG 2 cut(s) 179, 223
FblI GTMKAC 1 cut(s) 154
FokI GGATG 1 cut(s) 145
FriOI GRGCYC 1 cut(s) 70
FspBI CTAG 1 cut(s) 174
HgaI GACGC 1 cut(s) 131
Hin1II CATG 2 cut(s) 183, 227
Hpy166II GTNNAC 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 223
Hsp92II CATG 2 cut(s) 183, 227
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 1 cut(s) 62
MaeI CTAG 1 cut(s) 174
MboII GAAGA 3 cut(s) 53, 85, 156
MfeI CAATTG 1 cut(s) 18
MhlI GDGCHC 1 cut(s) 70
MluCI AATT 3 cut(s) 18, 30, 188
MmeI TCCRAC 1 cut(s) 43
MseI TTAA 1 cut(s) 192
MunI CAATTG 1 cut(s) 18
NlaIII CATG 2 cut(s) 183, 227
NspI RCATGY 1 cut(s) 227
PsiI TTATAA 1 cut(s) 29
Psp124BI GAGCTC 1 cut(s) 70
RsaI GTAC 1 cut(s) 178
RsaNI GTAC 1 cut(s) 177
SacI GAGCTC 1 cut(s) 70
SaqAI TTAA 1 cut(s) 192
SduI GDGCHC 1 cut(s) 70
SetI ASST 4 cut(s) 70, 109, 152, 218
SfcI CTRYAG 1 cut(s) 151
SgeI CNNG 6 cut(s) 81, 89, 127, 170, 186, 192
SpeI ACTAGT 1 cut(s) 173
Sse9I AATT 3 cut(s) 18, 30, 188
SsiI CCGC 1 cut(s) 9
SspMI CTAG 1 cut(s) 174
SstI GAGCTC 1 cut(s) 70
TaqI TCGA 1 cut(s) 53
TasI AATT 3 cut(s) 18, 30, 188
TatI WGTACW 1 cut(s) 176
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TspDTI ATGAA 3 cut(s) 17, 60, 85
TspGWI ACGGA 1 cut(s) 156
XceI RCATGY 1 cut(s) 227
XmiI GTMKAC 1 cut(s) 154
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.