Rmu_sc0003226.1_g000055

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003226.1
Physical Location & Seq
Reverse (-)
231065 .. 232329
1265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003226.1_g000055.1.cds

Sequence Viewer

Length: 525 bp
atgcacaacttaccccccaaccctccctcggaccccaacgggtaccaggggttcaagccctccctcggacccaacgggtaccggaggctcaagccctcatctaacctcataagggcctgtaggaatacccaagtgtcgtaccatgggtcgggttcacaacccaccatgatggtgttcatccaggatgacaccccggacacaaggggggtcggacctggccagcacggtcaatccaatgctgttcaggatgatattttccatgctcttcaaaacaacttcgaactggtcattgactcgattaacaacttgtgtgaccctccttggcgcatcaaacctcttatcagagatattcatcatatggtcaaagagttcgaagtaatttccttcaagcgtattcctcgtgaagctaactgtgttgcaaatgctatcaaaagcctaggccatgacgctttagaccctaacatatggaccaaaagattgtcacactctgctctctctgcttttaaatttgatctttcaatatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

19.46

Weight (kDa)

8.5

Isoelectric Point (pI)

31.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 2 cut(s) 42, 78
AccB1I GGYRCC 2 cut(s) 42, 78
AcoI YGGCCR 1 cut(s) 217
AcsI RAATTY 1 cut(s) 506
AfaI GTAC 3 cut(s) 44, 80, 140
AfiI CCNNNNNNNGG 4 cut(s) 28, 65, 112, 148
AgsI TTSAA 4 cut(s) 55, 269, 388, 519
AjnI CCWGG 3 cut(s) 45, 180, 214
AluBI AGCT 1 cut(s) 407
AluI AGCT 1 cut(s) 407
AoxI GGCC 3 cut(s) 114, 217, 439
ApoI RAATTY 1 cut(s) 506
Asp718I GGTACC 2 cut(s) 42, 78
AspA2I CCTAGG 1 cut(s) 436
AspLEI GCGC 1 cut(s) 327
AspS9I GGNCC 5 cut(s) 31, 68, 114, 212, 468
AsuC2I CCSGG 1 cut(s) 194
AsuII TTCGAA 2 cut(s) 279, 372
AvaII GGWCC 4 cut(s) 31, 68, 212, 468
AvrII CCTAGG 1 cut(s) 436
BalI TGGCCA 1 cut(s) 219
BanI GGYRCC 2 cut(s) 42, 78
BauI CACGAG 1 cut(s) 399
BccI CCATC 1 cut(s) 163
BciT130I CCWGG 3 cut(s) 47, 182, 216
BcnI CCSGG 1 cut(s) 194
BfaI CTAG 1 cut(s) 437
BfmI CTRYAG 1 cut(s) 118
BlnI CCTAGG 1 cut(s) 436
Bme1390I CCNGG 4 cut(s) 47, 182, 194, 216
Bme18I GGWCC 4 cut(s) 31, 68, 212, 468
BmgT120I GGNCC 5 cut(s) 31, 68, 114, 212, 468
BmiI GGNNCC 4 cut(s) 33, 44, 70, 80
BmrFI CCNGG 4 cut(s) 47, 182, 194, 216
BmsI GCATC 1 cut(s) 336
Bpu14I TTCGAA 2 cut(s) 279, 372
BpuEI CTTGAG 1 cut(s) 74
BpuMI CCSGG 1 cut(s) 194
BsaBI GATNNNNATC 1 cut(s) 351
BsaJI CCNNGG 7 cut(s) 27, 46, 64, 142, 192, 320, 436
BsaWI WCCGGW 1 cut(s) 81
Bsc4I CCNNNNNNNGG 4 cut(s) 28, 65, 112, 148
Bse1I ACTGG 1 cut(s) 288
Bse8I GATNNNNATC 1 cut(s) 351
BseBI CCWGG 3 cut(s) 47, 182, 216
BseDI CCNNGG 7 cut(s) 27, 46, 64, 142, 192, 320, 436
BseGI GGATG 3 cut(s) 177, 190, 253
BseJI GATNNNNATC 1 cut(s) 351
BseLI CCNNNNNNNGG 4 cut(s) 28, 65, 112, 148
BseNI ACTGG 1 cut(s) 288
BshFI GGCC 3 cut(s) 116, 219, 441
BshNI GGYRCC 2 cut(s) 42, 78
BsiSI CCGG 2 cut(s) 82, 194
BslI CCNNNNNNNGG 4 cut(s) 28, 65, 112, 148
BsnI GGCC 3 cut(s) 116, 219, 441
Bsp119I TTCGAA 2 cut(s) 279, 372
Bsp143I GATC 1 cut(s) 511
Bsp19I CCATGG 1 cut(s) 142
BspANI GGCC 3 cut(s) 116, 219, 441
BspLI GGNNCC 4 cut(s) 33, 44, 70, 80
BspQI GCTCTTC 1 cut(s) 270
BspT104I TTCGAA 2 cut(s) 279, 372
BspT107I GGYRCC 2 cut(s) 42, 78
BsrI ACTGG 1 cut(s) 288
BssECI CCNNGG 7 cut(s) 27, 46, 64, 142, 192, 320, 436
BssMI GATC 1 cut(s) 511
BssSI CACGAG 1 cut(s) 399
BssT1I CCWWGG 3 cut(s) 142, 320, 436
Bst2BI CACGAG 1 cut(s) 399
Bst2UI CCWGG 3 cut(s) 47, 182, 216
Bst4CI ACNGT 2 cut(s) 227, 413
Bst6I CTCTTC 1 cut(s) 270
BstBI TTCGAA 2 cut(s) 279, 372
BstC8I GCNNGC 1 cut(s) 221
BstDSI CCRYGG 1 cut(s) 142
BstF5I GGATG 3 cut(s) 177, 190, 253
BstHHI GCGC 1 cut(s) 327
BstKTI GATC 1 cut(s) 514
BstMBI GATC 1 cut(s) 511
BstMWI GCNNNNNNNGC 1 cut(s) 497
BstNI CCWGG 3 cut(s) 47, 182, 216
BstSCI CCNGG 4 cut(s) 45, 180, 192, 214
BstSFI CTRYAG 1 cut(s) 118
BstXI CCANNNNNNTGG 1 cut(s) 169
BsuRI GGCC 3 cut(s) 116, 219, 441
BtgI CCRYGG 1 cut(s) 142
BtsCI GGATG 3 cut(s) 177, 190, 253
Cac8I GCNNGC 1 cut(s) 221
CfoI GCGC 1 cut(s) 327
Cfr13I GGNCC 5 cut(s) 31, 68, 114, 212, 468
CseI GACGC 1 cut(s) 455
Csp6I GTAC 3 cut(s) 43, 79, 139
CviAII CATG 4 cut(s) 143, 166, 260, 443
CviJI RGCY 8 cut(s) 58, 88, 94, 116, 219, 407, 435, 441
CviKI_1 RGCY 8 cut(s) 58, 88, 94, 116, 219, 407, 435, 441
CviQI GTAC 3 cut(s) 43, 79, 139
DpnI GATC 1 cut(s) 513
DpnII GATC 1 cut(s) 511
DraI TTTAAA 1 cut(s) 505
EaeI YGGCCR 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 270
EarI CTCTTC 1 cut(s) 270
Eco130I CCWWGG 3 cut(s) 142, 320, 436
Eco47I GGWCC 4 cut(s) 31, 68, 212, 468
EcoO109I RGGNCCY 1 cut(s) 114
EcoRII CCWGG 3 cut(s) 45, 180, 214
EcoT14I CCWWGG 3 cut(s) 142, 320, 436
ErhI CCWWGG 3 cut(s) 142, 320, 436
FaeI CATG 4 cut(s) 146, 169, 263, 446
FatI CATG 4 cut(s) 142, 165, 259, 442
FauNDI CATATG 2 cut(s) 357, 464
FokI GGATG 3 cut(s) 164, 197, 260
FspBI CTAG 1 cut(s) 437
GlaI GCGC 1 cut(s) 326
HaeIII GGCC 3 cut(s) 116, 219, 441
HapII CCGG 2 cut(s) 82, 194
HgaI GACGC 1 cut(s) 455
HhaI GCGC 1 cut(s) 327
Hin1II CATG 4 cut(s) 146, 169, 263, 446
Hin6I GCGC 1 cut(s) 325
HinP1I GCGC 1 cut(s) 325
HinfI GANTC 1 cut(s) 293
HpaII CCGG 2 cut(s) 82, 194
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 4 cut(s) 31, 68, 212, 344
Hpy188III TCNNGA 2 cut(s) 245, 401
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 394
HpyCH4III ACNGT 2 cut(s) 227, 413
HpyCH4V TGCA 2 cut(s) 4, 419
HpyF10VI GCNNNNNNNGC 1 cut(s) 497
Hsp92II CATG 4 cut(s) 146, 169, 263, 446
HspAI GCGC 1 cut(s) 325
KpnI GGTACC 2 cut(s) 46, 82
Kzo9I GATC 1 cut(s) 511
LguI GCTCTTC 1 cut(s) 270
LweI GCATC 1 cut(s) 336
MaeI CTAG 1 cut(s) 437
MaeIII GTNAC 2 cut(s) 311, 480
MalI GATC 1 cut(s) 513
MboI GATC 1 cut(s) 511
MboII GAAGA 1 cut(s) 257
MlsI TGGCCA 1 cut(s) 219
MluCI AATT 2 cut(s) 378, 506
MluNI TGGCCA 1 cut(s) 219
MlyI GAGTC 1 cut(s) 287
MmeI TCCRAC 1 cut(s) 190
Mox20I TGGCCA 1 cut(s) 219
MscI TGGCCA 1 cut(s) 219
MseI TTAA 2 cut(s) 300, 504
MslI CAYNNNNRTG 2 cut(s) 167, 170
Msp20I TGGCCA 1 cut(s) 219
MspI CCGG 2 cut(s) 82, 194
MspR9I CCNGG 4 cut(s) 47, 182, 194, 216
MvaI CCWGG 3 cut(s) 47, 182, 216
MwoI GCNNNNNNNGC 1 cut(s) 497
NciI CCSGG 1 cut(s) 194
NcoI CCATGG 1 cut(s) 142
NdeI CATATG 2 cut(s) 357, 464
NdeII GATC 1 cut(s) 511
NlaIII CATG 4 cut(s) 146, 169, 263, 446
NlaIV GGNNCC 4 cut(s) 33, 44, 70, 80
NmuCI GTSAC 2 cut(s) 311, 480
NspV TTCGAA 2 cut(s) 279, 372
PciSI GCTCTTC 1 cut(s) 270
PfoI TCCNGGA 1 cut(s) 180
PleI GAGTC 1 cut(s) 287
PpsI GAGTC 1 cut(s) 287
Psp6I CCWGG 3 cut(s) 45, 180, 214
PspGI CCWGG 3 cut(s) 45, 180, 214
PspN4I GGNNCC 4 cut(s) 33, 44, 70, 80
PspPI GGNCC 5 cut(s) 31, 68, 114, 212, 468
PsrI GAACNNNNNNTAC 2 cut(s) 35, 67
RsaI GTAC 3 cut(s) 44, 80, 140
RsaNI GTAC 3 cut(s) 43, 79, 139
RseI CAYNNNNRTG 2 cut(s) 167, 170
SapI GCTCTTC 1 cut(s) 270
SaqAI TTAA 2 cut(s) 300, 504
Sau3AI GATC 1 cut(s) 511
Sau96I GGNCC 5 cut(s) 31, 68, 114, 212, 468
SchI GAGTC 1 cut(s) 287
ScrFI CCNGG 4 cut(s) 47, 182, 194, 216
SetI ASST 4 cut(s) 108, 217, 337, 409
SfaNI GCATC 1 cut(s) 336
SfcI CTRYAG 1 cut(s) 118
SfuI TTCGAA 2 cut(s) 279, 372
SinI GGWCC 4 cut(s) 31, 68, 212, 468
SmiMI CAYNNNNRTG 2 cut(s) 167, 170
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 2 cut(s) 378, 506
SspMI CTAG 1 cut(s) 437
StyD4I CCNGG 4 cut(s) 45, 180, 192, 214
StyI CCWWGG 3 cut(s) 142, 320, 436
TaaI ACNGT 2 cut(s) 227, 413
TaqI TCGA 3 cut(s) 279, 296, 372
TasI AATT 2 cut(s) 378, 506
Tru1I TTAA 2 cut(s) 300, 504
Tru9I TTAA 2 cut(s) 300, 504
TseFI GTSAC 2 cut(s) 311, 480
Tsp45I GTSAC 2 cut(s) 311, 480
TspDTI ATGAA 2 cut(s) 166, 341
VpaK11BI GGWCC 4 cut(s) 31, 68, 212, 468
XapI RAATTY 1 cut(s) 506
XmaJI CCTAGG 1 cut(s) 436
XspI CTAG 1 cut(s) 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.