RchiOBHm_Chr3g0459421

ZnF_TTF

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
7856112 .. 7857255
1144 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
ATGTTTCCTAAGAAATATGTTTCTGGTAGTGAAAAAAGAAAAAGAAAAAAACAGCAAGAAGATTTTATAAGCTCCCAAAGAGGTTCTTTAGATAAATTTTTTAACAAAAGATGTGTTTCTTCGGAAAATCAAGGTGAAAATGAGGTAACCCAAGGAGTTCAACATATAGATGAGAACGAAAATGAGGTAACTGATATAGGTGAACATGAGAATGAACAAACAGAAAATATGGAAGAGACAAATGTGCTTGAAAGTGAGAATATAGGTGAACATGAGAATGATCAAACAGAAAAGATGGAAGAAACAAATGTGCTTAAGAAGATTTTAGAACTGATTACTTTCCTGTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.54

Weight (kDa)

4.68

Isoelectric Point (pI)

51.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 68
AcsI RAATTY 1 cut(s) 95
AflII CTTAAG 1 cut(s) 314
AgsI TTSAA 2 cut(s) 161, 251
AluBI AGCT 1 cut(s) 72
AluI AGCT 1 cut(s) 72
Alw26I GTCTC 1 cut(s) 230
ApoI RAATTY 1 cut(s) 95
AsuHPI GGTGA 3 cut(s) 146, 212, 278
BccI CCATC 1 cut(s) 289
BclI TGATCA 1 cut(s) 280
BcoDI GTCTC 1 cut(s) 230
BfrI CTTAAG 1 cut(s) 314
BsaJI CCNNGG 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 230
Bsp143I GATC 1 cut(s) 280
BspTI CTTAAG 1 cut(s) 314
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 1 cut(s) 280
BssT1I CCWWGG 1 cut(s) 151
Bst6I CTCTTC 1 cut(s) 228
BstAFI CTTAAG 1 cut(s) 314
BstDEI CTNAG 2 cut(s) 9, 348
BstEII GGTNACC 1 cut(s) 145
BstKTI GATC 1 cut(s) 283
BstMAI GTCTC 1 cut(s) 230
BstMBI GATC 1 cut(s) 280
BstPI GGTNACC 1 cut(s) 145
CviAII CATG 2 cut(s) 206, 272
CviJI RGCY 1 cut(s) 72
CviKI_1 RGCY 1 cut(s) 72
DdeI CTNAG 2 cut(s) 9, 348
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco130I CCWWGG 1 cut(s) 151
Eco91I GGTNACC 1 cut(s) 145
EcoO65I GGTNACC 1 cut(s) 145
EcoT14I CCWWGG 1 cut(s) 151
ErhI CCWWGG 1 cut(s) 151
FaeI CATG 2 cut(s) 209, 275
FaiI YATR 9 cut(s) 18, 68, 165, 167, 197, 207, 230, 263, 273
FalI AAGNNNNNCTT 2 cut(s) 70, 102
FatI CATG 2 cut(s) 205, 271
FbaI TGATCA 1 cut(s) 280
Hin1II CATG 2 cut(s) 209, 275
HphI GGTGA 3 cut(s) 146, 212, 278
Hpy166II GTNNAC 2 cut(s) 203, 269
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 2 cut(s) 203, 269
HpyF3I CTNAG 2 cut(s) 9, 348
Hsp92II CATG 2 cut(s) 209, 275
Ksp22I TGATCA 1 cut(s) 280
Kzo9I GATC 1 cut(s) 280
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 1 cut(s) 9
MaeIII GTNAC 2 cut(s) 145, 187
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MboII GAAGA 5 cut(s) 71, 111, 245, 311, 331
MluCI AATT 1 cut(s) 95
MnlI CCTC 3 cut(s) 74, 136, 178
MseI TTAA 2 cut(s) 102, 315
MslI CAYNNNNRTG 3 cut(s) 168, 210, 276
MspCI CTTAAG 1 cut(s) 314
NdeII GATC 1 cut(s) 280
NlaIII CATG 2 cut(s) 209, 275
PsiI TTATAA 1 cut(s) 68
PspEI GGTNACC 1 cut(s) 145
RseI CAYNNNNRTG 3 cut(s) 168, 210, 276
SaqAI TTAA 2 cut(s) 102, 315
Sau3AI GATC 1 cut(s) 280
SetI ASST 7 cut(s) 74, 85, 136, 147, 189, 202, 268
SgeI CNNG 7 cut(s) 36, 68, 143, 164, 218, 260, 284
SmiMI CAYNNNNRTG 3 cut(s) 168, 210, 276
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 1 cut(s) 95
StyI CCWWGG 1 cut(s) 151
TasI AATT 1 cut(s) 95
Tru1I TTAA 2 cut(s) 102, 315
Tru9I TTAA 2 cut(s) 102, 315
TspDTI ATGAA 1 cut(s) 228
Vha464I CTTAAG 1 cut(s) 314
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.