Rh1DG451700

Zinc finger MYM-type protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
65929593 .. 65931007
1415 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG451700.1

Sequence Viewer

Length: 513 bp
ATGTTTCCTAAGAAATATGTTTCTGGTAGTGAAAAAAGAAAAAGAAAAAAACAACAAGAAGATTTTATAAGCTCCCAAAGAGGTTCTTTAGATAAGTTTTTTATGAAAAGAGATGTTTCTTCAGAAAATCATGGTGAAACTGAGGTAACTGAAGGAGTTCAAGATATAGGTGAGTCTGGTGAGAACGAAAATGAGGTAGCGGAAAGAGTTGAAGATATAGGTGAAACTGAAAATGAGGTAGCCGAAGGAGTTGAAGATATAGGTGAAACTGAAAATGAGGTAGCCGAAGCAATAAAATGTCAATTTCCCAAAATAAAAGAAGCTTTAGTCAAACTTGCTGAAGTTGGTGATGCATATGATAATCATTTGAGTTGGGAAGTTGGGAAATTATTAGATGGTGAATTTTCAAGTTTTGATTTCATTTTAAGTCTGGTTATATGGCATGATATTTTGCACAAAATAAACATGGTGAGCAAAAATTTGCAGGCTAAAGATATGAAAAGAATATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

170

Amino Acids

19.33

Weight (kDa)

4.76

Isoelectric Point (pI)

38.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 68
AciI CCGC 1 cut(s) 200
AcsI RAATTY 2 cut(s) 401, 478
AcuI CTGAAG 3 cut(s) 105, 171, 360
AgsI TTSAA 4 cut(s) 161, 212, 254, 408
AluBI AGCT 2 cut(s) 72, 323
AluI AGCT 2 cut(s) 72, 323
ApoI RAATTY 2 cut(s) 401, 478
Asp700I GAANNNNTTC 1 cut(s) 156
AsuHPI GGTGA 8 cut(s) 146, 182, 191, 233, 275, 359, 410, 481
BccI CCATC 1 cut(s) 389
BmsI GCATC 1 cut(s) 340
BseMII CTCAG 1 cut(s) 132
BspACI CCGC 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 486
BstDEI CTNAG 2 cut(s) 9, 141
Cac8I GCNNGC 1 cut(s) 486
CviAII CATG 3 cut(s) 131, 443, 466
CviJI RGCY 5 cut(s) 72, 242, 284, 323, 488
CviKI_1 RGCY 5 cut(s) 72, 242, 284, 323, 488
DdeI CTNAG 2 cut(s) 9, 141
Eco57I CTGAAG 3 cut(s) 105, 171, 360
EcoT22I ATGCAT 1 cut(s) 355
FaeI CATG 3 cut(s) 134, 446, 469
FalI AAGNNNNNCTT 2 cut(s) 70, 102
FatI CATG 3 cut(s) 130, 442, 465
FauNDI CATATG 1 cut(s) 355
Hin1II CATG 3 cut(s) 134, 446, 469
HindIII AAGCTT 1 cut(s) 321
HinfI GANTC 1 cut(s) 173
HphI GGTGA 8 cut(s) 146, 182, 191, 233, 275, 359, 410, 481
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 161
HpyAV CCTTC 2 cut(s) 146, 239
HpyCH4V TGCA 3 cut(s) 353, 454, 484
HpyF3I CTNAG 2 cut(s) 9, 141
Hsp92II CATG 3 cut(s) 134, 446, 469
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 4 cut(s) 9, 162, 416, 470
LweI GCATC 1 cut(s) 340
MaeIII GTNAC 1 cut(s) 145
MboII GAAGA 4 cut(s) 71, 111, 224, 266
MluCI AATT 4 cut(s) 302, 386, 401, 478
MlyI GAGTC 1 cut(s) 182
MnlI CCTC 5 cut(s) 74, 136, 187, 229, 271
Mph1103I ATGCAT 1 cut(s) 355
MroXI GAANNNNTTC 1 cut(s) 156
MseI TTAA 1 cut(s) 425
NdeI CATATG 1 cut(s) 355
NlaIII CATG 3 cut(s) 134, 446, 469
NsiI ATGCAT 1 cut(s) 355
PdmI GAANNNNTTC 1 cut(s) 156
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
PsiI TTATAA 1 cut(s) 68
SaqAI TTAA 1 cut(s) 425
SchI GAGTC 1 cut(s) 182
SfaNI GCATC 1 cut(s) 340
Sse9I AATT 4 cut(s) 302, 386, 401, 478
SsiI CCGC 1 cut(s) 200
TasI AATT 4 cut(s) 302, 386, 401, 478
Tru1I TTAA 1 cut(s) 425
Tru9I TTAA 1 cut(s) 425
TspDTI ATGAA 3 cut(s) 119, 409, 512
XapI RAATTY 2 cut(s) 401, 478
XmnI GAANNNNTTC 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.