RchiOBHm_Chr3g0487861

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
35272707 .. 35275968
3262 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45228

Sequence Viewer

Length: 126 bp
ATGATCAAGAATTCGAGGAGAGAGAAAACAGATCTGGGATTTCTTTCTCCTCCATTGCTAACGATGCTGGGGTCTTCTTCAAGTGAAAGAGACTTTGCAGAAAGATTTGTGGAGAGAACCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

4.73

Weight (kDa)

9.68

Isoelectric Point (pI)

58.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AgsI TTSAA 1 cut(s) 81
Alw26I GTCTC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 10
BbsI GAAGAC 1 cut(s) 66
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 84
BglII AGATCT 1 cut(s) 31
BmsI GCATC 1 cut(s) 54
BpiI GAAGAC 1 cut(s) 66
Bse3DI GCAATG 1 cut(s) 53
BseMI GCAATG 1 cut(s) 53
BseRI GAGGAG 2 cut(s) 31, 39
BseYI CCCAGC 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 84
Bsp143I GATC 2 cut(s) 3, 31
BsrDI GCAATG 1 cut(s) 53
BssMI GATC 2 cut(s) 3, 31
BstKTI GATC 2 cut(s) 6, 34
BstMAI GTCTC 1 cut(s) 84
BstMBI GATC 2 cut(s) 3, 31
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 66
BstX2I RGATCY 1 cut(s) 31
BstYI RGATCY 1 cut(s) 31
DpnI GATC 2 cut(s) 5, 33
DpnII GATC 2 cut(s) 3, 31
EcoRI GAATTC 1 cut(s) 10
FbaI TGATCA 1 cut(s) 3
FspEI CC 8 cut(s) 20, 21, 53, 54, 55, 63, 66, 95
GsaI CCCAGC 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 31
LpnPI CCDG 2 cut(s) 20, 53
LweI GCATC 1 cut(s) 54
MalI GATC 2 cut(s) 5, 33
MboI GATC 2 cut(s) 3, 31
MboII GAAGA 2 cut(s) 66, 69
MflI RGATCY 1 cut(s) 31
MluCI AATT 1 cut(s) 10
MnlI CCTC 2 cut(s) 9, 60
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 2 cut(s) 3, 31
PspFI CCCAGC 1 cut(s) 67
PsuI RGATCY 1 cut(s) 31
Sau3AI GATC 2 cut(s) 3, 31
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 5 cut(s) 19, 27, 47, 80, 93
Sse9I AATT 1 cut(s) 10
TaqI TCGA 1 cut(s) 14
TasI AATT 1 cut(s) 10
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.