RchiOBHm_Chr5g0035771

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001198
Physical Location & Seq
Forward (+)
29765206 .. 29769346
4141 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31461

Sequence Viewer

Length: 150 bp
ATGGCGGAGAGAGAAAGCACACATATGATCAAGAATTCGAGGAGAGAGAAAACAGATCTGGGATTTCTTTCTCCTCCATTGCTAACGATGCTGGGGTCTTCTTCAAGTGAAAGAGACTTTGCAGAAAGATTTGTGGAGAGAACCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.67

Weight (kDa)

8.27

Isoelectric Point (pI)

57.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AcsI RAATTY 1 cut(s) 34
AgsI TTSAA 1 cut(s) 105
Alw26I GTCTC 1 cut(s) 108
ApoI RAATTY 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 90
BclI TGATCA 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 108
BglII AGATCT 1 cut(s) 55
BmsI GCATC 1 cut(s) 78
BpiI GAAGAC 1 cut(s) 90
Bse3DI GCAATG 1 cut(s) 77
BseMI GCAATG 1 cut(s) 77
BseRI GAGGAG 2 cut(s) 55, 63
BseYI CCCAGC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 108
Bsp143I GATC 2 cut(s) 27, 55
BspACI CCGC 1 cut(s) 5
BsrDI GCAATG 1 cut(s) 77
BssMI GATC 2 cut(s) 27, 55
BstKTI GATC 2 cut(s) 30, 58
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 2 cut(s) 27, 55
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstV2I GAAGAC 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
DpnI GATC 2 cut(s) 29, 57
DpnII GATC 2 cut(s) 27, 55
EciI GGCGGA 1 cut(s) 20
EcoRI GAATTC 1 cut(s) 34
FaiI YATR 2 cut(s) 24, 26
FauNDI CATATG 1 cut(s) 24
FbaI TGATCA 1 cut(s) 27
FspEI CC 9 cut(s) 25, 44, 45, 77, 78, 79, 87, 90, 119
GsaI CCCAGC 1 cut(s) 95
Hpy188III TCNNGA 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 2 cut(s) 27, 55
LpnPI CCDG 2 cut(s) 44, 77
LweI GCATC 1 cut(s) 78
MalI GATC 2 cut(s) 29, 57
MboI GATC 2 cut(s) 27, 55
MboII GAAGA 2 cut(s) 90, 93
MflI RGATCY 1 cut(s) 55
MluCI AATT 1 cut(s) 34
MnlI CCTC 2 cut(s) 33, 84
MslI CAYNNNNRTG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 88
NdeI CATATG 1 cut(s) 24
NdeII GATC 2 cut(s) 27, 55
PspFI CCCAGC 1 cut(s) 91
PsuI RGATCY 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 23
Sau3AI GATC 2 cut(s) 27, 55
SfaNI GCATC 1 cut(s) 78
SgeI CNNG 5 cut(s) 43, 51, 71, 104, 117
SmiMI CAYNNNNRTG 1 cut(s) 23
Sse9I AATT 1 cut(s) 34
SsiI CCGC 1 cut(s) 5
TaqI TCGA 1 cut(s) 38
TasI AATT 1 cut(s) 34
XapI RAATTY 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.