Rh6AG270600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
46405673 .. 46413827
8155 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG270600.1

Sequence Viewer

Length: 216 bp
ATGATGACCATTGATCCTATAATAAGACAGTTCAATTTGATGCCACAACTTCAAAATGAGATTATGGAACAAGAGCAATTACTAGTGGATGGGAATCAGGATGGGGATCGAAAAATCGGATATTGGGGATTGAGATCGAAAATCACGTACGGAATCAAGGATTTAAATTTCATCAAAATTATAAAATTTTCGAAACTTACCCTTATCGATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.36

Weight (kDa)

6.12

Isoelectric Point (pI)

24.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 182
AclWI GGATC 2 cut(s) 8, 114
AcsI RAATTY 2 cut(s) 166, 185
AfaI GTAC 1 cut(s) 149
AgsI TTSAA 2 cut(s) 34, 53
AhlI ACTAGT 1 cut(s) 82
AlwI GGATC 2 cut(s) 8, 114
ApoI RAATTY 2 cut(s) 166, 185
AsuII TTCGAA 1 cut(s) 191
BccI CCATC 2 cut(s) 83, 95
BcuI ACTAGT 1 cut(s) 82
BfaI CTAG 1 cut(s) 83
BmsI GCATC 1 cut(s) 30
Bpu14I TTCGAA 1 cut(s) 191
Bsa29I ATCGAT 1 cut(s) 207
BsaAI YACGTR 1 cut(s) 147
BsaBI GATNNNNATC 3 cut(s) 93, 105, 133
Bse8I GATNNNNATC 3 cut(s) 93, 105, 133
BseCI ATCGAT 1 cut(s) 207
BseGI GGATG 2 cut(s) 94, 106
BseJI GATNNNNATC 3 cut(s) 93, 105, 133
BshVI ATCGAT 1 cut(s) 207
BsiWI CGTACG 1 cut(s) 147
Bsp119I TTCGAA 1 cut(s) 191
Bsp143I GATC 3 cut(s) 13, 106, 134
BspDI ATCGAT 1 cut(s) 207
BspPI GGATC 2 cut(s) 8, 114
BspT104I TTCGAA 1 cut(s) 191
BssMI GATC 3 cut(s) 13, 106, 134
Bst4CI ACNGT 1 cut(s) 30
BstBAI YACGTR 1 cut(s) 147
BstBI TTCGAA 1 cut(s) 191
BstF5I GGATG 2 cut(s) 94, 106
BstKTI GATC 3 cut(s) 16, 109, 137
BstMBI GATC 3 cut(s) 13, 106, 134
Bsu15I ATCGAT 1 cut(s) 207
BsuTUI ATCGAT 1 cut(s) 207
BtsCI GGATG 2 cut(s) 94, 106
ClaI ATCGAT 1 cut(s) 207
Csp6I GTAC 1 cut(s) 148
CviQI GTAC 1 cut(s) 148
DpnI GATC 3 cut(s) 15, 108, 136
DpnII GATC 3 cut(s) 13, 106, 134
DraI TTTAAA 1 cut(s) 165
FaiI YATR 3 cut(s) 20, 65, 182
FokI GGATG 2 cut(s) 101, 113
FspBI CTAG 1 cut(s) 83
HinfI GANTC 2 cut(s) 94, 153
Hpy188I TCNGA 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4III ACNGT 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 146
Kzo9I GATC 3 cut(s) 13, 106, 134
LpnPI CCDG 1 cut(s) 83
LweI GCATC 1 cut(s) 30
MaeI CTAG 1 cut(s) 83
MaeII ACGT 1 cut(s) 146
MalI GATC 3 cut(s) 15, 108, 136
MboI GATC 3 cut(s) 13, 106, 134
MluCI AATT 5 cut(s) 34, 77, 166, 177, 185
MseI TTAA 1 cut(s) 164
NdeII GATC 3 cut(s) 13, 106, 134
NspV TTCGAA 1 cut(s) 191
PcsI WCGNNNNNNNCGW 1 cut(s) 143
PfeI GAWTC 2 cut(s) 94, 153
Pfl23II CGTACG 1 cut(s) 147
Ppu21I YACGTR 1 cut(s) 147
PsiI TTATAA 1 cut(s) 182
PspLI CGTACG 1 cut(s) 147
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 3 cut(s) 13, 106, 134
SetI ASST 1 cut(s) 149
SfaNI GCATC 1 cut(s) 30
SfuI TTCGAA 1 cut(s) 191
SgeI CNNG 5 cut(s) 83, 95, 110, 157, 169
SmiI ATTTAAAT 1 cut(s) 165
SpeI ACTAGT 1 cut(s) 82
Sse9I AATT 5 cut(s) 34, 77, 166, 177, 185
SspMI CTAG 1 cut(s) 83
SwaI ATTTAAAT 1 cut(s) 165
TaaI ACNGT 1 cut(s) 30
TaiI ACGT 1 cut(s) 149
TaqI TCGA 4 cut(s) 109, 137, 191, 207
TasI AATT 5 cut(s) 34, 77, 166, 177, 185
TfiI GAWTC 2 cut(s) 94, 153
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 160
TspGWI ACGGA 1 cut(s) 165
XapI RAATTY 2 cut(s) 166, 185
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.