Rh5DG184700

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
20466188 .. 20470920
4733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG184700.1

Sequence Viewer

Length: 201 bp
ATGCTTCAGATCAAATTCGAAATCAAGAGATGCAGTTCACCTATGGAATCAATGATTTACCAAAGTGTGATGGTAGTGGAGGACGCATATGAAGTGTTCGATGAATTACCTTTGAAAGATGTGATGCTTTGGAATAGAATGATCAATTGGTTTTCCGAGATTGGGCAGTTGAGGAGGCTTTGCTGGTCACTAGGGTCTTGA

Protein Analysis

66

Amino Acids

7.92

Weight (kDa)

4.89

Isoelectric Point (pI)

68.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 162
AgsI TTSAA 1 cut(s) 115
AjuI GAANNNNNNNTTGG 2 cut(s) 130, 162
ApoI RAATTY 1 cut(s) 14
AsuHPI GGTGA 1 cut(s) 30
AsuII TTCGAA 1 cut(s) 18
BccI CCATC 1 cut(s) 64
BclI TGATCA 1 cut(s) 141
BfaI CTAG 1 cut(s) 191
BmsI GCATC 2 cut(s) 20, 114
Bpu14I TTCGAA 1 cut(s) 18
Bsc4I CCNNNNNNNGG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 162
BseRI GAGGAG 1 cut(s) 187
BslI CCNNNNNNNGG 1 cut(s) 162
Bsp119I TTCGAA 1 cut(s) 18
Bsp143I GATC 2 cut(s) 9, 141
BspT104I TTCGAA 1 cut(s) 18
BssMI GATC 2 cut(s) 9, 141
BstBI TTCGAA 1 cut(s) 18
BstKTI GATC 2 cut(s) 12, 144
BstMBI GATC 2 cut(s) 9, 141
CseI GACGC 1 cut(s) 92
CviJI RGCY 1 cut(s) 178
CviKI_1 RGCY 1 cut(s) 178
DpnI GATC 2 cut(s) 11, 143
DpnII GATC 2 cut(s) 9, 141
FaiI YATR 3 cut(s) 44, 88, 90
FauNDI CATATG 1 cut(s) 88
FbaI TGATCA 1 cut(s) 141
FspBI CTAG 1 cut(s) 191
HgaI GACGC 1 cut(s) 92
HinfI GANTC 1 cut(s) 47
HphI GGTGA 1 cut(s) 30
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 2 cut(s) 9, 157
Hpy188III TCNNGA 2 cut(s) 25, 198
Hpy8I GTNNAC 1 cut(s) 38
HpyCH4V TGCA 1 cut(s) 33
Ksp22I TGATCA 1 cut(s) 141
Kzo9I GATC 2 cut(s) 9, 141
LpnPI CCDG 1 cut(s) 169
LweI GCATC 2 cut(s) 20, 114
MaeI CTAG 1 cut(s) 191
MaeIII GTNAC 1 cut(s) 186
MalI GATC 2 cut(s) 11, 143
MboI GATC 2 cut(s) 9, 141
MfeI CAATTG 1 cut(s) 145
MluCI AATT 3 cut(s) 14, 104, 145
MnlI CCTC 3 cut(s) 73, 165, 168
MunI CAATTG 1 cut(s) 145
NdeI CATATG 1 cut(s) 88
NdeII GATC 2 cut(s) 9, 141
NmuCI GTSAC 1 cut(s) 186
NspV TTCGAA 1 cut(s) 18
PfeI GAWTC 1 cut(s) 47
Sau3AI GATC 2 cut(s) 9, 141
SetI ASST 2 cut(s) 43, 112
SfaNI GCATC 2 cut(s) 20, 114
SfuI TTCGAA 1 cut(s) 18
SgeI CNNG 3 cut(s) 37, 169, 196
Sse9I AATT 3 cut(s) 14, 104, 145
SspMI CTAG 1 cut(s) 191
TaqI TCGA 2 cut(s) 18, 99
TasI AATT 3 cut(s) 14, 104, 145
TfiI GAWTC 1 cut(s) 47
TseFI GTSAC 1 cut(s) 186
Tsp45I GTSAC 1 cut(s) 186
TspDTI ATGAA 2 cut(s) 105, 117
XapI RAATTY 1 cut(s) 14
XspI CTAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.