Rh7DG208100

belongs to the flavoprotein pyridine nucleotide cytochrome reductase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
19874614 .. 19876083
1470 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG208100.1

Sequence Viewer

Length: 198 bp
ATGAAGAAGCATATTGGCATGATTGCAGGTGGTTCTGGTATTACTCCAATGCTTCAGGTCATTGACGCTACACTAAAAAATCTTGATGACACAACCAAGGTTACTGGGATATATCGGGCTTTGAGCGTAAGAGTTGGACCAACACAGAGAACTGCAAAATCATTATTCAAGGCATACTTCTATCTTTTACTCCGTTAA

Protein Analysis

65

Amino Acids

7.17

Weight (kDa)

10.28

Isoelectric Point (pI)

11.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAD_binding_1 PF00175 7 - 36 2.2e-06 Oxidoreductase NAD-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 17
Acc36I ACCTGC 1 cut(s) 17
AcuI CTGAAG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 137
AvaII GGWCC 1 cut(s) 137
BfuAI ACCTGC 1 cut(s) 17
Bme18I GGWCC 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 137
BmrI ACTGGG 1 cut(s) 114
BmuI ACTGGG 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 109
BspMI ACCTGC 1 cut(s) 17
BsrI ACTGG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 96
BssT1I CCWWGG 1 cut(s) 96
BveI ACCTGC 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 137
CseI GACGC 1 cut(s) 74
CviAII CATG 1 cut(s) 19
CviJI RGCY 1 cut(s) 119
CviKI_1 RGCY 1 cut(s) 119
Eco130I CCWWGG 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 137
Eco57I CTGAAG 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 96
ErhI CCWWGG 1 cut(s) 96
FaeI CATG 1 cut(s) 22
FaiI YATR 4 cut(s) 12, 20, 112, 175
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FatI CATG 1 cut(s) 18
HgaI GACGC 1 cut(s) 74
Hin1II CATG 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 83
HpyCH4V TGCA 2 cut(s) 26, 155
Hsp92II CATG 1 cut(s) 22
LpnPI CCDG 4 cut(s) 12, 21, 41, 90
MaeIII GTNAC 1 cut(s) 100
MboII GAAGA 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 115
MseI TTAA 1 cut(s) 196
NlaIII CATG 1 cut(s) 22
PaqCI CACCTGC 1 cut(s) 17
PspPI GGNCC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 137
SetI ASST 3 cut(s) 31, 60, 102
SgeI CNNG 9 cut(s) 31, 39, 48, 68, 95, 109, 117, 128, 181
SinI GGWCC 1 cut(s) 137
StyI CCWWGG 1 cut(s) 96
Tru1I TTAA 1 cut(s) 196
Tru9I TTAA 1 cut(s) 196
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 182
VpaK11BI GGWCC 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.