Rmu_sc0028697.1_g000001

belongs to the flavoprotein pyridine nucleotide cytochrome reductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028697.1
Physical Location & Seq
Forward (+)
11 .. 735
725 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028697.1_g000001.1.cds

Sequence Viewer

Length: 235 bp
atgagccagcattttgcaagcttaaaaccaggcgatgtagtcgaagtgaaggggcccattgaaaagctgagatatgttcccaacatgaagaaacatattggcatgattgcaggtggtactggtataactcctatgcttcaggtcattgaggctatacttaaaaatcctgatgacacaaccaaggtgtcgctggtttatgctaatgtctcaccagatgacatactgcttaaacaga

Protein Analysis

78

Amino Acids

8.5

Weight (kDa)

8.03

Isoelectric Point (pI)

41.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 101
Acc36I ACCTGC 1 cut(s) 101
AcuI CTGAAG 1 cut(s) 122
AfaI GTAC 1 cut(s) 118
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 2 cut(s) 21, 67
AluI AGCT 2 cut(s) 21, 67
Alw26I GTCTC 1 cut(s) 211
AoxI GGCC 1 cut(s) 53
ApaI GGGCCC 1 cut(s) 57
AspS9I GGNCC 2 cut(s) 53, 54
AsuHPI GGTGA 1 cut(s) 201
BaeGI GKGCMC 1 cut(s) 57
BanII GRGCYC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 211
BfuAI ACCTGC 1 cut(s) 101
Bme1390I CCNGG 1 cut(s) 30
BmgT120I GGNCC 2 cut(s) 53, 54
BmiI GGNNCC 2 cut(s) 54, 55
BmrFI CCNGG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 180
Bse1I ACTGG 1 cut(s) 124
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 180
BseMII CTCAG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 124
BseSI GKGCMC 1 cut(s) 57
BshFI GGCC 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 211
BsnI GGCC 1 cut(s) 55
Bsp120I GGGCCC 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 57
BspANI GGCC 1 cut(s) 55
BspCNI CTCAG 1 cut(s) 60
BspLI GGNNCC 2 cut(s) 54, 55
BspMI ACCTGC 1 cut(s) 101
BsrI ACTGG 1 cut(s) 124
BssECI CCNNGG 1 cut(s) 180
BssT1I CCWWGG 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 30
BstC8I GCNNGC 2 cut(s) 8, 19
BstDEI CTNAG 1 cut(s) 68
BstMAI GTCTC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstSLI GKGCMC 1 cut(s) 57
BsuRI GGCC 1 cut(s) 55
BtgZI GCGATG 1 cut(s) 48
BveI ACCTGC 1 cut(s) 101
Cac8I GCNNGC 2 cut(s) 8, 19
Cfr13I GGNCC 2 cut(s) 53, 54
Csp6I GTAC 1 cut(s) 117
CviAII CATG 2 cut(s) 85, 103
CviJI RGCY 5 cut(s) 6, 21, 55, 67, 152
CviKI_1 RGCY 5 cut(s) 6, 21, 55, 67, 152
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 1 cut(s) 68
Eco130I CCWWGG 1 cut(s) 180
Eco24I GRGCYC 1 cut(s) 57
Eco57I CTGAAG 1 cut(s) 122
EcoO109I RGGNCCY 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 28
EcoT14I CCWWGG 1 cut(s) 180
EcoT38I GRGCYC 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 2 cut(s) 88, 106
FaiI YATR 9 cut(s) 75, 86, 96, 104, 125, 134, 155, 198, 221
FatI CATG 2 cut(s) 84, 102
FriOI GRGCYC 1 cut(s) 57
HaeIII GGCC 1 cut(s) 55
Hin1II CATG 2 cut(s) 88, 106
HindIII AAGCTT 1 cut(s) 19
HphI GGTGA 1 cut(s) 201
Hpy188III TCNNGA 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 17, 110
HpyF3I CTNAG 1 cut(s) 68
Hsp92II CATG 2 cut(s) 88, 106
LpnPI CCDG 9 cut(s) 15, 20, 42, 96, 105, 125, 176, 180, 225
MboII GAAGA 1 cut(s) 100
MhlI GDGCHC 1 cut(s) 57
MnlI CCTC 1 cut(s) 142
MseI TTAA 3 cut(s) 23, 159, 228
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NlaIII CATG 2 cut(s) 88, 106
NlaIV GGNNCC 2 cut(s) 54, 55
PaqCI CACCTGC 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 2 cut(s) 54, 55
PspOMI GGGCCC 1 cut(s) 53
PspPI GGNCC 2 cut(s) 53, 54
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
SaqAI TTAA 3 cut(s) 23, 159, 228
Sau96I GGNCC 2 cut(s) 53, 54
ScrFI CCNGG 1 cut(s) 30
SduI GDGCHC 1 cut(s) 57
SetI ASST 5 cut(s) 23, 69, 115, 144, 186
StyD4I CCNGG 1 cut(s) 28
StyI CCWWGG 1 cut(s) 180
TaqI TCGA 1 cut(s) 42
Tru1I TTAA 3 cut(s) 23, 159, 228
Tru9I TTAA 3 cut(s) 23, 159, 228
TspDTI ATGAA 1 cut(s) 101
XcmI CCANNNNNNNNNTGG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.