RchiOBHm_Chr6g0246661

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001198
Physical Location & Seq
Reverse (-)
2350121 .. 2353644
3524 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22111

Sequence Viewer

Length: 174 bp
ATGGATTGGGACTTGAAAGTTGCATATATTGAAGAAGTTGGGAAGACCAGGTTTTTTAAACTCCTAGAGGCAGTGGTTTGGGAGTTCAAGGATTTTGCTAACCAACTACAACATCTTCCGCAGCTGCAACTGAAACAATCACCTTTTGAACAACCGGAGCACTTACTATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.92

Weight (kDa)

5.14

Isoelectric Point (pI)

56.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 119
AgsI TTSAA 4 cut(s) 16, 32, 88, 149
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
Alw21I GWGCWC 1 cut(s) 162
ApeKI GCWGC 2 cut(s) 121, 124
AsuHPI GGTGA 1 cut(s) 132
BbsI GAAGAC 1 cut(s) 50
Bbv12I GWGCWC 1 cut(s) 162
BbvI GCAGC 2 cut(s) 111, 133
BciT130I CCWGG 1 cut(s) 49
BfaI CTAG 1 cut(s) 65
BisI GCNGC 2 cut(s) 122, 125
BlsI GCNGC 2 cut(s) 123, 126
Bme1390I CCNGG 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 49
BpiI GAAGAC 1 cut(s) 50
BsaWI WCCGGW 1 cut(s) 154
BseBI CCWGG 1 cut(s) 49
BseXI GCAGC 2 cut(s) 111, 133
BsiHKAI GWGCWC 1 cut(s) 162
BsiSI CCGG 1 cut(s) 155
BslFI GGGAC 1 cut(s) 23
BsmFI GGGAC 1 cut(s) 23
Bsp1286I GDGCHC 1 cut(s) 162
BspACI CCGC 1 cut(s) 119
Bst2UI CCWGG 1 cut(s) 49
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
BstV1I GCAGC 2 cut(s) 111, 133
BstV2I GAAGAC 1 cut(s) 50
BtsI GCAGTG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 78
CsiI ACCWGGT 1 cut(s) 47
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DraI TTTAAA 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 47
FaiI YATR 2 cut(s) 25, 27
FaqI GGGAC 1 cut(s) 23
Fnu4HI GCNGC 2 cut(s) 122, 125
Fsp4HI GCNGC 2 cut(s) 122, 125
FspBI CTAG 1 cut(s) 65
GluI GCNGC 2 cut(s) 122, 125
HapII CCGG 1 cut(s) 155
HpaII CCGG 1 cut(s) 155
HphI GGTGA 1 cut(s) 132
HpyCH4V TGCA 2 cut(s) 23, 127
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 3 cut(s) 34, 61, 168
Lsp1109I GCAGC 2 cut(s) 111, 133
MabI ACCWGGT 1 cut(s) 47
MaeI CTAG 1 cut(s) 65
MboII GAAGA 3 cut(s) 44, 55, 107
MhlI GDGCHC 1 cut(s) 162
MnlI CCTC 1 cut(s) 61
MseI TTAA 1 cut(s) 57
MspA1I CMGCKG 1 cut(s) 124
MspI CCGG 1 cut(s) 155
MspR9I CCNGG 1 cut(s) 49
MvaI CCWGG 1 cut(s) 49
PkrI GCNGC 2 cut(s) 123, 126
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
PvuII CAGCTG 1 cut(s) 124
SaqAI TTAA 1 cut(s) 57
SatI GCNGC 2 cut(s) 122, 125
ScrFI CCNGG 1 cut(s) 49
SduI GDGCHC 1 cut(s) 162
SetI ASST 3 cut(s) 53, 126, 145
SexAI ACCWGGT 1 cut(s) 47
SgeI CNNG 6 cut(s) 25, 60, 61, 77, 100, 167
SsiI CCGC 1 cut(s) 119
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 47
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TscAI CASTG 1 cut(s) 78
TseI GCWGC 2 cut(s) 121, 124
TspRI CASTG 1 cut(s) 78
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.