RchiOBHm_Chr2g0146031

Sister chromatid cohesion 1 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
63777178 .. 63780943
3766 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGGAGTGGAGTCGGAAGAAATCATACCAACTTCAATGGCATAGGTTCTCTCAAGAAGAATGTGCCAACATTGATACAGTTATTGGCATTGAGAAAAAAAAAACTCAAAACCAAGTCAAGCCATATGGTCTAGATAATGAAACTATTGGAGAGCGGATAAAGATCCAAATATAG

Protein Analysis

57

Amino Acids

6.84

Weight (kDa)

8.85

Isoelectric Point (pI)

40.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 154
AciI CCGC 1 cut(s) 154
AclWI GGATC 1 cut(s) 157
AgsI TTSAA 1 cut(s) 35
AlwI GGATC 1 cut(s) 157
BarI GAAGNNNNNNTAC 2 cut(s) 8, 40
BfaI CTAG 1 cut(s) 131
BpuEI CTTGAG 1 cut(s) 36
BsaBI GATNNNNATC 1 cut(s) 161
Bse8I GATNNNNATC 1 cut(s) 161
BseJI GATNNNNATC 1 cut(s) 161
Bsp143I GATC 1 cut(s) 162
BspACI CCGC 1 cut(s) 154
BspPI GGATC 1 cut(s) 157
BsrBI CCGCTC 1 cut(s) 154
BssMI GATC 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 79
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
BstX2I RGATCY 1 cut(s) 162
BstYI RGATCY 1 cut(s) 162
CviJI RGCY 1 cut(s) 121
CviKI_1 RGCY 1 cut(s) 121
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
FaiI YATR 5 cut(s) 25, 42, 124, 126, 172
FauNDI CATATG 1 cut(s) 124
FspBI CTAG 1 cut(s) 131
HinfI GANTC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 2 cut(s) 53, 131
HpyCH4III ACNGT 1 cut(s) 79
Kzo9I GATC 1 cut(s) 162
MaeI CTAG 1 cut(s) 131
MalI GATC 1 cut(s) 164
MbiI CCGCTC 1 cut(s) 154
MboI GATC 1 cut(s) 162
MboII GAAGA 2 cut(s) 28, 68
MflI RGATCY 1 cut(s) 162
MlyI GAGTC 1 cut(s) 19
NdeI CATATG 1 cut(s) 124
NdeII GATC 1 cut(s) 162
PleI GAGTC 1 cut(s) 18
PpsI GAGTC 1 cut(s) 18
PsuI RGATCY 1 cut(s) 162
Sau3AI GATC 1 cut(s) 162
SchI GAGTC 1 cut(s) 19
SetI ASST 1 cut(s) 47
SgeI CNNG 4 cut(s) 65, 125, 130, 143
SmlI CTYRAG 1 cut(s) 51
SmoI CTYRAG 1 cut(s) 51
SsiI CCGC 1 cut(s) 154
SspMI CTAG 1 cut(s) 131
TaaI ACNGT 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 153
XbaI TCTAGA 1 cut(s) 130
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.