RchiOBHm_Chr2g0172161

Sister chromatid cohesion 1 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
85631277 .. 85633204
1928 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53946

Sequence Viewer

Length: 288 bp
ATGGGTTTTCTGTTTAGCTTATTTGAGAGCCTACTTGTTAAGTTTTCTGTGATTGACATTAGTGGGAATAATTGGTTGTTTGCAGAATCTAGAGATAAAATTTTGAAGGATGATTGGGATGTCATCGCATATAGGGTACTGGCCTACCTTCTTCTTGGTGTTGTTCGGATATACTCCAAAAAAGTTGAATACCTTTTTGATGTCTGCCATGAGGTGCTAACTGAAATCAACAAGTTTGTCGTTAGCACAAAAGAGAAGGGAGACACAGATACGTTTCTTGCACCTTAG

Protein Analysis

95

Amino Acids

10.99

Weight (kDa)

5.01

Isoelectric Point (pI)

22.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad21_Rec8_N PF04825 31 - 86 1.8e-10 N terminus of Rad21 / Rec8 like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 99
AfaI GTAC 1 cut(s) 138
AgsI TTSAA 2 cut(s) 106, 188
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 255
AoxI GGCC 1 cut(s) 141
ApoI RAATTY 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 255
BfaI CTAG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 144
BseGI GGATG 2 cut(s) 115, 124
BseNI ACTGG 1 cut(s) 144
BshFI GGCC 1 cut(s) 143
BsmAI GTCTC 1 cut(s) 255
BsnI GGCC 1 cut(s) 143
BspANI GGCC 1 cut(s) 143
BsrI ACTGG 1 cut(s) 144
BstDEI CTNAG 1 cut(s) 285
BstF5I GGATG 2 cut(s) 115, 124
BstMAI GTCTC 1 cut(s) 255
BsuRI GGCC 1 cut(s) 143
BtgZI GCGATG 1 cut(s) 109
BtsCI GGATG 2 cut(s) 115, 124
Csp6I GTAC 1 cut(s) 137
CviAII CATG 1 cut(s) 209
CviJI RGCY 3 cut(s) 18, 30, 143
CviKI_1 RGCY 3 cut(s) 18, 30, 143
CviQI GTAC 1 cut(s) 137
DdeI CTNAG 1 cut(s) 285
FaeI CATG 1 cut(s) 212
FaiI YATR 4 cut(s) 130, 132, 172, 210
FatI CATG 1 cut(s) 208
FokI GGATG 2 cut(s) 122, 131
FspBI CTAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 143
Hin1II CATG 1 cut(s) 212
HinfI GANTC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 90
HpyAV CCTTC 3 cut(s) 100, 158, 250
HpyCH4IV ACGT 1 cut(s) 272
HpyCH4V TGCA 2 cut(s) 83, 281
HpyF3I CTNAG 1 cut(s) 285
HpySE526I ACGT 1 cut(s) 272
Hsp92II CATG 1 cut(s) 212
LpnPI CCDG 1 cut(s) 125
MaeI CTAG 1 cut(s) 90
MaeII ACGT 1 cut(s) 272
MboII GAAGA 1 cut(s) 143
MluCI AATT 2 cut(s) 70, 99
MnlI CCTC 1 cut(s) 205
MseI TTAA 1 cut(s) 39
NlaIII CATG 1 cut(s) 212
PfeI GAWTC 1 cut(s) 86
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 39
SetI ASST 6 cut(s) 20, 150, 195, 216, 275, 286
SgeI CNNG 6 cut(s) 47, 102, 152, 167, 221, 244
Sse9I AATT 2 cut(s) 70, 99
SspMI CTAG 1 cut(s) 90
TaiI ACGT 1 cut(s) 275
TasI AATT 2 cut(s) 70, 99
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
XapI RAATTY 1 cut(s) 99
XbaI TCTAGA 1 cut(s) 89
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.