RchiOBHm_Chr2g0173841

Sister chromatid cohesion 1 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
86683510 .. 86684064
555 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGAAAAGTGTTCTGGAAGAACATCCAGATCCCCTCTCAGTTGCATATTATGGCAGTCCTGATGCCAAGCAGCCAGATGCTATAGGTGTTACTACAATAAAATTGACGGCTGTTCCCAGACCAGCTTCCAAGAAGTTGGCTTGGATTTCTAGTAAAAGAAAGTGTGTCTTTGATTTAGTAGTGCTGCCTAATAAGTGA

Protein Analysis

65

Amino Acids

7.11

Weight (kDa)

9.46

Isoelectric Point (pI)

41.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 23
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AlwI GGATC 1 cut(s) 23
ApeKI GCWGC 2 cut(s) 70, 184
BbvI GCAGC 2 cut(s) 82, 171
BceAI ACGGC 1 cut(s) 123
BfaI CTAG 1 cut(s) 150
BfmI CTRYAG 1 cut(s) 81
BisI GCNGC 2 cut(s) 71, 185
BlsI GCNGC 2 cut(s) 72, 186
BmsI GCATC 2 cut(s) 52, 67
BseGI GGATG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 51
BseXI GCAGC 2 cut(s) 82, 171
Bsp143I GATC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 50
BspPI GGATC 1 cut(s) 23
BssMI GATC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 81
BstV1I GCAGC 2 cut(s) 82, 171
BstX2I RGATCY 1 cut(s) 28
BstXI CCANNNNNNTGG 1 cut(s) 136
BstYI RGATCY 1 cut(s) 28
BtsCI GGATG 1 cut(s) 22
CviJI RGCY 4 cut(s) 73, 110, 125, 140
CviKI_1 RGCY 4 cut(s) 73, 110, 125, 140
DdeI CTNAG 1 cut(s) 37
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
FaiI YATR 3 cut(s) 46, 51, 83
FalI AAGNNNNNCTT 2 cut(s) 152, 184
Fnu4HI GCNGC 2 cut(s) 71, 185
FokI GGATG 1 cut(s) 9
Fsp4HI GCNGC 2 cut(s) 71, 185
FspBI CTAG 1 cut(s) 150
GluI GCNGC 2 cut(s) 71, 185
Hpy188III TCNNGA 3 cut(s) 14, 26, 59
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 37
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 5 cut(s) 39, 72, 87, 130, 135
Lsp1109I GCAGC 2 cut(s) 82, 171
LweI GCATC 2 cut(s) 52, 67
MaeI CTAG 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 88
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 1 cut(s) 29
MflI RGATCY 1 cut(s) 28
MluCI AATT 1 cut(s) 101
MnlI CCTC 1 cut(s) 44
NdeII GATC 1 cut(s) 28
PkrI GCNGC 2 cut(s) 72, 186
PsuI RGATCY 1 cut(s) 28
SatI GCNGC 2 cut(s) 71, 185
Sau3AI GATC 1 cut(s) 28
SetI ASST 2 cut(s) 88, 127
SfaNI GCATC 2 cut(s) 52, 67
SfcI CTRYAG 1 cut(s) 81
Sse9I AATT 1 cut(s) 101
SspMI CTAG 1 cut(s) 150
TasI AATT 1 cut(s) 101
TseI GCWGC 2 cut(s) 70, 184
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.