RchiOBHm_Chr1g0325401

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001095
Physical Location & Seq
Forward (+)
13360434 .. 13362882
2449 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55513

Sequence Viewer

Length: 159 bp
ATGGAAAATGGAAATAAAGTTGAAGTCTTTGTTCTTAAGAAGCAGAACTCAGATGAGGTCGTCAAAAGTGGTAGCTCTTCACAAAACCAATGCTTAAGTAAGGTGTTGTATAAGGTTAACTTCTACGAGTTCAGGATATGGAACAAAAAGCTGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.11

Weight (kDa)

9.46

Isoelectric Point (pI)

32.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 2 cut(s) 35, 94
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 2 cut(s) 75, 151
AluI AGCT 2 cut(s) 75, 151
ApeKI GCWGC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 138
BfrI CTTAAG 2 cut(s) 35, 94
BisI GCNGC 1 cut(s) 152
BlsI GCNGC 1 cut(s) 153
BseMII CTCAG 1 cut(s) 63
BseXI GCAGC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 62
BspQI GCTCTTC 1 cut(s) 82
BspTI CTTAAG 2 cut(s) 35, 94
Bst6I CTCTTC 1 cut(s) 82
BstAFI CTTAAG 2 cut(s) 35, 94
BstDEI CTNAG 1 cut(s) 49
BstV1I GCAGC 1 cut(s) 138
CviJI RGCY 2 cut(s) 75, 151
CviKI_1 RGCY 2 cut(s) 75, 151
DdeI CTNAG 1 cut(s) 49
Eam1104I CTCTTC 1 cut(s) 82
EarI CTCTTC 1 cut(s) 82
FaiI YATR 2 cut(s) 111, 139
FalI AAGNNNNNCTT 2 cut(s) 104, 136
Fnu4HI GCNGC 1 cut(s) 152
Fsp4HI GCNGC 1 cut(s) 152
FspEI CC 7 cut(s) 41, 54, 86, 98, 101, 118, 124
GluI GCNGC 1 cut(s) 152
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HpaI GTTAAC 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 154
HpyF3I CTNAG 1 cut(s) 49
KspAI GTTAAC 1 cut(s) 118
LguI GCTCTTC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 118
Lsp1109I GCAGC 1 cut(s) 138
MboII GAAGA 1 cut(s) 69
MnlI CCTC 1 cut(s) 49
MseI TTAA 3 cut(s) 36, 95, 117
MspCI CTTAAG 2 cut(s) 35, 94
PciSI GCTCTTC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 153
SapI GCTCTTC 1 cut(s) 82
SaqAI TTAA 3 cut(s) 36, 95, 117
SatI GCNGC 1 cut(s) 152
SetI ASST 5 cut(s) 60, 77, 105, 117, 153
SgeI CNNG 2 cut(s) 139, 145
SmlI CTYRAG 2 cut(s) 35, 94
SmoI CTYRAG 2 cut(s) 35, 94
Tru1I TTAA 3 cut(s) 36, 95, 117
Tru9I TTAA 3 cut(s) 36, 95, 117
TseI GCWGC 1 cut(s) 151
Vha464I CTTAAG 2 cut(s) 35, 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.