Rh3DG262600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0001095
Physical Location & Seq
Reverse (-)
26092231 .. 26094668
2438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG262600.1

Sequence Viewer

Length: 189 bp
ATGGGTCTAAAGAGGCAAAAGTCTGTGATTCTACTTGGTGGACTTGCGAAGGTTGTGGATGGACATGTGAGGATAGTACATATGCATGACAAATTGCAAGTAGTCATGTACAACAGTACAAATCAAGATCAAGCAATTCTCACCTACAAAGAATGCGTTAACAATGCTCTGCTGGAAATTCTCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.97

Weight (kDa)

8.93

Isoelectric Point (pI)

45.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 177
AfaI GTAC 3 cut(s) 78, 110, 118
AflIII ACRYGT 1 cut(s) 64
ApoI RAATTY 1 cut(s) 177
AsuHPI GGTGA 1 cut(s) 133
BccI CCATC 1 cut(s) 53
BseGI GGATG 1 cut(s) 64
BsmI GAATGC 1 cut(s) 158
Bsp1407I TGTACA 1 cut(s) 108
Bsp143I GATC 1 cut(s) 127
BsrGI TGTACA 1 cut(s) 108
BssMI GATC 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 116
BstAUI TGTACA 1 cut(s) 108
BstF5I GGATG 1 cut(s) 64
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstNSI RCATGY 1 cut(s) 68
BtsCI GGATG 1 cut(s) 64
Csp6I GTAC 3 cut(s) 77, 109, 117
CviAII CATG 3 cut(s) 65, 86, 106
CviQI GTAC 3 cut(s) 77, 109, 117
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
EcoT22I ATGCAT 1 cut(s) 87
FaeI CATG 3 cut(s) 68, 89, 109
FaiI YATR 5 cut(s) 66, 81, 83, 87, 107
FatI CATG 3 cut(s) 64, 85, 105
FauNDI CATATG 1 cut(s) 81
FokI GGATG 1 cut(s) 71
FspEI CC 8 cut(s) 21, 24, 35, 41, 45, 55, 157, 158
Hin1II CATG 3 cut(s) 68, 89, 109
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HinfI GANTC 1 cut(s) 28
HpaI GTTAAC 1 cut(s) 160
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 2 cut(s) 41, 160
Hpy188III TCNNGA 1 cut(s) 125
Hpy8I GTNNAC 2 cut(s) 41, 160
HpyAV CCTTC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 85, 97
Hsp92II CATG 3 cut(s) 68, 89, 109
KspAI GTTAAC 1 cut(s) 160
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 1 cut(s) 158
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MluCI AATT 4 cut(s) 92, 135, 177, 184
MnlI CCTC 2 cut(s) 6, 63
Mph1103I ATGCAT 1 cut(s) 87
MseI TTAA 1 cut(s) 159
MslI CAYNNNNRTG 1 cut(s) 84
Mva1269I GAATGC 1 cut(s) 158
NdeI CATATG 1 cut(s) 81
NdeII GATC 1 cut(s) 127
NlaIII CATG 3 cut(s) 68, 89, 109
NsiI ATGCAT 1 cut(s) 87
NspI RCATGY 1 cut(s) 68
PciI ACATGT 1 cut(s) 64
PctI GAATGC 1 cut(s) 158
PfeI GAWTC 1 cut(s) 28
PscI ACATGT 1 cut(s) 64
RsaI GTAC 3 cut(s) 78, 110, 118
RsaNI GTAC 3 cut(s) 77, 109, 117
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 1 cut(s) 159
Sau3AI GATC 1 cut(s) 127
SetI ASST 2 cut(s) 54, 146
SgeI CNNG 9 cut(s) 47, 56, 77, 98, 110, 118, 137, 143, 185
SmiMI CAYNNNNRTG 1 cut(s) 84
Sse9I AATT 4 cut(s) 92, 135, 177, 184
TaaI ACNGT 1 cut(s) 116
TasI AATT 4 cut(s) 92, 135, 177, 184
TatI WGTACW 3 cut(s) 76, 108, 116
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
XapI RAATTY 1 cut(s) 177
XceI RCATGY 1 cut(s) 68
Zsp2I ATGCAT 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.