RchiOBHm_Chr5g0084011

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
89646675 .. 89647105
431 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35811

Sequence Viewer

Length: 219 bp
ATGAAGGGAACTGTTATAGGAGGAGTGCAAGCTATGCTTCTACAGGTACTCCCATTGTGCTTGTGTCTGTTTTGCATAAAAACAACAGAATATGAAATTGGTGTAGGGCTAAACACAAAATATAGAATTACTGATTTAGTTTGGCATACATATAGTTTCCAATCTGCAGAATGTAGTTACCTTAGTGATATCAGGCTCTTGATGTTAGGTCGGGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.09

Weight (kDa)

7.65

Isoelectric Point (pI)

33.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 48
AjuI GAANNNNNNNTTGG 2 cut(s) 81, 113
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AoxI GGCC 1 cut(s) 213
AspS9I GGNCC 1 cut(s) 213
BfmI CTRYAG 2 cut(s) 41, 165
BmgT120I GGNCC 1 cut(s) 213
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
BseRI GAGGAG 1 cut(s) 36
BshFI GGCC 1 cut(s) 215
BsnI GGCC 1 cut(s) 215
BspANI GGCC 1 cut(s) 215
BspMAI CTGCAG 1 cut(s) 169
Bst4CI ACNGT 1 cut(s) 13
BstAPI GCANNNNNTGC 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 1 cut(s) 182
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstSFI CTRYAG 2 cut(s) 41, 165
BsuRI GGCC 1 cut(s) 215
Cac8I GCNNGC 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 213
Csp6I GTAC 1 cut(s) 47
CviJI RGCY 4 cut(s) 32, 109, 196, 215
CviKI_1 RGCY 4 cut(s) 32, 109, 196, 215
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 1 cut(s) 182
Eco32I GATATC 1 cut(s) 190
EcoRV GATATC 1 cut(s) 190
FaiI YATR 8 cut(s) 17, 35, 77, 93, 123, 147, 151, 153
FalI AAGNNNNNCTT 2 cut(s) 21, 53
HaeIII GGCC 1 cut(s) 215
Hpy188III TCNNGA 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4V TGCA 3 cut(s) 28, 75, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 182
LpnPI CCDG 2 cut(s) 29, 178
MaeIII GTNAC 1 cut(s) 176
MluCI AATT 2 cut(s) 96, 126
MnlI CCTC 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 34
PspPI GGNCC 1 cut(s) 213
PstI CTGCAG 1 cut(s) 169
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
Sau96I GGNCC 1 cut(s) 213
SetI ASST 4 cut(s) 34, 48, 183, 211
SfcI CTRYAG 2 cut(s) 41, 165
SgeI CNNG 5 cut(s) 41, 56, 73, 205, 211
Sse9I AATT 2 cut(s) 96, 126
TaaI ACNGT 1 cut(s) 13
TasI AATT 2 cut(s) 96, 126
TspDTI ATGAA 2 cut(s) 17, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.